Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y52B11A.9   

sjj_Y52B11A.9 RNAi JA:Y52B11A.9
Simmer:Y52B11A.9:Screen_A
Simmer:Y52B11A.9:Screen_B
PCR_productsjj_Y52B11A.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY52B11A.9 Source_evidenceePCR903WS150 Sequence/Annotation Release
Overlaps_Gene Y52B11A.9 Source_evidenceePCR911WS150 Sequence/Annotation Release
Chunk_score Abs_score848
Max_abs_score848Y52B11A.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1103663011038861
Overlaps_transcriptY52B11A.9 Source_evidenceePCR911WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y52B11A.92232aatcaccttaacaacaatcccctctctcatccaataatccttccgattcttccgctcctttttcctctcctccatctccttaatctcatctagcgctgactttttcgagaattttttggcggccgggctccggctccgggatctctttttaccacttttgcgtgatggttgtgatggtcccggctcatccggatcctcttttttgacttttggcatatcgaaaatcgagattttcgccgacgccacaccacttttaacgtccaatttccgatctagaatccccaaatttaaatccagctgaattttctgatccggagtatccctgatgagctctgtggcttcatattcgtgctcatcatccccggcgagctcttttcctcgttggaccatcccgtccataatctgcatatgacgctcttcgtcatccttctcctgttgctgttttcgttgatcttcttcttttcggattaaggcttcttgatcgatatatgcaatataccatcctttatcaccttcgtcgattttacattttccagatgatccgagatactggacgaagcctgtcaacgagtgccatactgtagagttcatgtgcacgtgaccctgaaatttggtgattggtggctccgaacgtaagtcagcgccctagcagaaccgatcagcagtcctataagctcaaaaatgcgggttcagcttgattttaaaggtttaaaaccttgaaaatcaagttgaactcgggattttgaacttatggaacaagcttcatggtgctgctagggcgaggtgcaattttgagggaaaatttagagaatttggagcttttcggctcaaattattggaatatgttgttgtagtccttagaaggctataaactgcagattgggttgaatttttccgtttttcagacaaaaatttaacaaatttcaaaattttaggctaatttcaattttcaaaaactacgaaattgaccgcaaattatttaaaaataaaaatttcatggatttatgaaaattttaacaaaaattaaattttttaaaggttttttttcggaaaaacctttccaaatgttcccaatttggttgaggctcacagactacaaactacaaaattttgcgggaaactgaattttttcaaatattttacgttaaaaattcaattctgaaccttaaaatcaaaattgttccaatttttagcgaaaaaaataaattttcattttgggtgagggtcagagacccctatgagctccattacaaactacaaaatttctagcctctaccaaagttttttgagataaattttacatttttcagtttaaaactggatttttttgttcaattgttctgaattttgaattcaaaaatgcagttttacactgaaagtttcgaaaaaatggcaaaaatcctttttaaatcttgattgaggctcacagactacaaactacaacattttcagcctcaccaaacatttctcacttgaaaactggatttttttgtccaatttaactgaattttcaattcgaaaatgcagttttacactaaaagttgagcaaaaaatacgaaatttggccaaaaatcgtgaaaatccttttaaaaatgggcaaactacaaactacaacatttttcagcctcaaccaaattcaaaaacttgtttttaatggttttttgccgattttaatgcatttttcggcgtttttccggcaatttcttcaagttttcttgaaatttctcttaccttatctttaataaacgcattatacacctcattggcacgaactcgcttcgttccgtacgaagttcgcagcaactgcatgaaattcttctcaaaatcattggaaaactgtcggagataggaattcgagttctcggcaaagagcaaaagttgccgttgatgtgcttcggaagttaagtggcatttgaagccgttcgcgtctcgacactgcttttggcacatttggcagaagctggaaataataataatcatttttattaatttttaactgtttaattgaatatttcgttaattttaactcaatttaaccagcaaaaaccgacaaaaatcgcttaaaattaattatttttaaatttttacttaaaaagtgccatacaatttcaatttttgtaatcctttcgattttgttcgatttgccaagtcttttgaacttcctttttcgtgttttcccatttttaaatctgaaaaaattaggaattttaggtgaaaaagcttgaaaaagct