Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y52D5A.c   

sjj_Y52D5A.c RNAi JA:Y52D5A.c
Simmer:Y52D5A.c
PCR_productsjj_Y52D5A.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST11F8.3 Source_evidenceePCR2159WS150 Sequence/Annotation Release
Overlaps_Gene T11F8.3 Source_evidenceePCR2193WS150 Sequence/Annotation Release
Chunk_score Abs_score2067
Max_abs_score2067T11F8.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV54699805472407
Overlaps_transcriptT11F8.3 Source_evidenceePCR2193WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y52D5A.c2428tgccattctttcattcttttcataatctcactcaccatgagaaccatgcgccttgcttggttgctcccactttttattcacatactaatcaaggtaatttccccgtttttctagttttttcaatgtattttcatgtttcagaacacagctcaagctccggctgtcaacaactcgacatgcgatcaagcaaaggaatttgattgcgggaacgggagactccgatgcattcccgcggagtggcaatgcgacaacgtagcggactgcgacaacggaagagacgaatcgggctgctcatatgcgcatcattgttcgacaagcttcatgttatgcaagaatggactgtgtgtcgcaaatgagttcaaatgcgacggcgaagacgactgccgcgatggaagcgatgagcagcattgcgagtacaatatcctgaagtctcgcttcgatggttccaatccttcggctcctaccactttcgttggtcacaatggcccagaatgccatcctcctcgtttacgatgccgatcaggacaatgtattcaaccagatctcgtttgtgatggacatacggattgttctggaggagatgatgaggtcaactgcaccagaaggggacatgaaaatatgcagtcctcgactgattttcacgatgatgttcatcttgtcgatccaacctttttcgctaatgaagacaataaggtaattgtttaatgtttattaataccgttttaacttttatttttcagtgtcggagtggatacacaatgtgccatagcggagacgtctgcatacctgacagttttctttgtgacggcgatctagattgtgatgatgcttcggacgagaaaaactgccaaactaatgctccaagcgaagaagaatatctttctgggcaagccgatcacatgcattcgtgctcagcagcaggaatgtattcttgtggaacaaaaggatccgaaattggcgtttgtattccgatgaatgccacgtgtaatgggatcaaggagtgtccactaggagatgacgagtcaaaacattgctccgaatgtgccagaaagcgatgtgaccacacatgtatgaacactccacacggggctcgctgcatttgtcaagaaggatataagcttgccgatgacggactcacttgcgaggatgaagatgagtgtgcaactcatgggcacttgtgccagcatttctgtgaagatcgtttgggttcctttgcatgcaaatgtgccaacggttatgagcttgaaacggatgggcattcttgtaaatacgagacaaccactacgccagaaggatatttgttcatcagtcttggtggagaagttcgacagatgccattggcagatttcaccgatggttcaaattactcgccgattcaaaagtttgctggccacggaaccatcagatcgatcgacttcatgcatcgcaacaacaaaatgttcatgtcaatttctgatgagcacggtgatccaactggcgaattgtcagtgtccgacaatggattgatgagagttcttcgagaaaatgtcattggagtgagcaacgtggcagtcgactggattggtggaaacgttttcttcacacaaaaatgtatgtttatctaatgtttaaatttttcatttgtgattcttacagctccatctccaagcgctgggatttccatctgcacaatgagcggaatgttctgtcgccgagttatcgaaggcaaagaacaaggacaatcctatcgtggtcttgttgttcacccgatgcgcggtctcatcatctggatcgattcttatcagaaatatcatcgcatcatgatggctaatatggatgggtctcaggtgagtcgtcgagtcgatctgatttagttcatttctaaataaatttcaggtcagaatccttctcgacaacaagttggaagttccatcagctcttgccatcgactacatccgccacgatgtctattttggagatgttgaacgtcagttgatcgaaagagtcaatatcgacacgaaagagcgccgcgtagtgatttcgaacggagttcatcatccgtatgacatggcttacttcaatggtttcctatactgggcagattggtaagacatcttatctaatttatattttcaaatttatttttcaggggaagcgagtcattaaaggttcaagagatgacccatcatcattcgagtcctcaagtcatccatactttcaatcgttatccatatggtattgctgtcaatcactcactctaccagactggtcctccatcaaacccatgccttgaactcgagtgcccatggctctgcgttattgtgccaaagagcgatttcattatgactgccaagtgtgtctgcccagacggatacactcattccgtcactgaaaactcttgcatcccgcctgtgacgattgaggacgaggagaaccttgagaagctttc