Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y53C12A.1   

sjj_Y53C12A.1 RNAi (6)
PCR_productsjj_Y53C12A.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY53C12A.1 Source_evidenceePCR1060WS150 Sequence/Annotation Release
Overlaps_Gene Y53C12A.1 Source_evidenceePCR1063WS150 Sequence/Annotation Release
Chunk_score Abs_score1000
Max_abs_score1000Y53C12A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII97151979716378
Overlaps_transcriptY53C12A.1 Source_evidenceePCR1063WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y53C12A.11182ccggatgatcaagcaaatctcgacttgttggacgaatcctcggatcagagtcaagcatcaaggcaattaaactgcgaagatctgtagaaattccagcgaagaatctatcaggaatctgtccatttctgatttgatgccacgaatctccatttgatggaacgtcaagatcagtagtagcctcaagaattgtcattcctagactgaaaatgtctgatgatttcgtgggacggccgttcaaaacttctggagcaagatatttcgagtcaccttcttccgctgatttcacatcatttggctgaaaatcgattgaataaaatcagaatattaaaaagtatgaacttacatttttaaggttaataaccaaaccaaaatctccgagtttgcatatcatgtcctttgtaagaaaaatgttttccggtttaatatcatcatgaatcatgtcgttcgagtgcaaatgatgaacagcttggagcaaatctacgaaaatattccaaatttcgtcctccggtagtgcatgtttctctgtacaatatttcaaaagactttgatcgcaaagttctgtttgaatatacaatcgaccagtttcctcccaggctctgtagaacttgacaagattcttatgcggtggaatgatcatatggctctcagcttctcggtacttggaaattgaatgttgccggatcggagctaacgatactttgacagcatacaattgggaatcctcacggcatctggctgcgaatacttctccgaacgagcctcttccaatgatttcatcgatttgaaatacttgttcaaagaatgattgagcatttgtatgatcgtactttggcgattccagtggttttggtcctgaaaaaatgcttgagatgtgttgggtttatcaaaaataattaatgtttaaaataatcaactcgacataccctgcggagtgaccaaaagtgggaccgactccttccgaacagaccaaatgcttcttgttggtggcatagtttttatcattttcggagctggacgacggaaacgtggagtaattgcttggcgctcacgttttgtggaaagtggtgtctcacgcatcatcatcgggatttgtggtaagcgtggagtgacctgtggaagtggacttgattgaccatttcgaatggaatccatcgaggagttaccctctgtgtcgtccatttt