Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y53F4B.f   

sjj_Y53F4B.fRNAiJA:Y53F4B.f
PCR_productsjj_Y53F4B.f
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y53F4B.4a Source_evidenceePCR285WS150 Sequence/Annotation Release
Y53F4B.4b Source_evidenceePCR285WS150 Sequence/Annotation Release
Overlaps_Gene Y53F4B.4 Source_evidenceePCR376WS150 Sequence/Annotation Release
Chunk_score Abs_score355
Max_abs_score355Y53F4B.4
Specificity_index0.843
Rel_score1
Map_statusUnique_ePCRII1497648614977304
Y67H2A.9 Chunk_score Abs_score66
Specificity_index0.157
Rel_score0.186
Overlaps_transcript Y53F4B.4b Source_evidenceePCR376WS150 Sequence/Annotation Release
Y53F4B.4a Source_evidenceePCR285WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y53F4B.f819tctaacatcacatttttcaggcaatgatcctaaagcacgctctgaagcttcccggcctgaaacgagccgtctactcaacatgctctgtacacgaagaagaaaatgagcaagttgttgatgaagtgctcctggacacgtatgtccgtcaaaattatgtgctcaagaagaatgtgctcccagaatggacatatcgcggactgaagacctatgaagttggagaacattgtttgagagcaaatccgaaggtcacacttaccaatggattttttgtcgctgtttttgaacgggtcaagagctcggaataatttcatggaattgtgtttttttttgttactgaaattgatatatttgttgagttattgagtttttgttgttgaaaattgaaaattaaataaatattgttttcgaaaaaccaggatgttgattttttcaaaaatcagtttcgacaaaggctcatttacatcaaatgtatccaagaataatctgaaaaatctaagaaccatatcggtttgatctacaaaaaatgctggaattttttgtccaaaaataatgtgacgtcagcacgttcttaaccatgcgaaatcagttgagaactctgcgtctcttctcccgcattttttgtagatcaaccgaaatggggctttctgacaccacgagcattatactcgttatttgaaaactaacaaaacattttaaaaactccatgtctaacacaatctatatagatcttccttgttctttcatttcatcacgatactttaatattttaaaatagttcttttccatctgaccgtacatgttcctattaaaggtggtgca