Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y53H1C.a   

sjj_Y53H1C.aRNAiJA:Y53H1C.a
PCR_productsjj_Y53H1C.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F56G4.5 Source_evidenceePCR879WS150 Sequence/Annotation Release
Chunk_score Abs_score774
Max_abs_score774F56G4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1138637111388746
Y53H1C.1 Source_evidenceePCR11WS150 Sequence/Annotation Release
Overlaps_transcript F56G4.5.1 Source_evidenceePCR879WS150 Sequence/Annotation Release
Y53H1C.1a Source_evidenceePCR11WS150 Sequence/Annotation Release
F56G4.5.2 Source_evidenceePCR801WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y53H1C.a2376tttttccaggtaactcaacgaaatgaagtccgacagccggtttttgagaatttcctctcaaaattaaattcccgccaagcggaaggtcaaacggagccgagaaaacgagaattagccgtccgccgggtctgtgagctcatggaaatgatggctcaggaggcgaaaaatcacaaaatcggctgggagaagattggcgatgatttgggtggaagaattacaggttggcgctcgaaaattgcacgaaaaatgagcaaaaacagagaattttgagccggtggccataaattctgattctagaccacctgtatagtagacctcgaaattacctattaattggtttttgctgcattcaaaaatgttgattttccgccgagttacagcgattttaagttggtggccgaggtttttctaggccaccaacttaaaatcgctgaaacttggcggaaaatcaatatttttgaaatctagtcaataatctgaactgagctcaatgagatcttcaaaacagtacccattttgtctgggttactgtagattttccaaattttcgtggcgagacccaacatttttcgtgaattttcaaaattgtcagaacctaggcatgatgggtgtcaaatgaaagctcttggcgtgctgatcacgcctttgagactttgattgccaagttttcaaattggtggcctagaaaattggaaaaactaggccaccaacttgaaatcgctgtaactcggcgaaaaatcgatatttttcagttctgaaagcacttttcaactcagtaatgactagaggattcgtggcgggactcgatttttcagatttttagttttgagtatctagtggcctagagatttggaaaactaggccaccactgaaaaatctttttttttcggtgaaattttgagattttctcagtttagataggtttttgactaatttcaatgcgaaaaatcaatattttcagcaaaagtttctcagaaatcgataaaaaatcgtatttggtggcctagaattataaaaaactaggccaccaactttatctccttttttttttcaaaattcatatttttcaggatccgaagagtggcgtcgtgaacgtggtgagcttggggaatccggcccaaagttgctcgcggagcccataaaactggccccgcccaccggccccgcccagaactacttggaattcaattatgacgtcatcactgacacatactctcaaccgcctgaaattggattttcagctcaagcttttgagctggaaaatgtgcagagagtcgaggaaaccgactggaatatgacatatttgtgtaggaaacgaggagacgcgccgggaaatgtaaggaattggtggcctaggatttgcaagaaattaggccaccagataaaaaatgaagagcttgaaatttccattcgattagtttttgtttgacgtgaaaatatcgattttccgccgagttacggcgtttttaagtaggtggcctaggaatccaaaaaaagtttcaaggccaccaacttaaaatcgtcatagcttggctgaaaatcgattttttcaaagtctaaaagaaactttgaattcagaaaataaaaataatactgattttcatcaaattccaatagttttcgcggcgagacccagaaaattttggaaattttcaaaattcccagaacccagtcatgatgggtgtcaaatgaaaggtttcggcgagctgaatacgatattgacactttgatggcctagttttcaacttggtggcctagaaacttgaaaaactaggccaccaactggaaattggcgaaaaatcgatttttctctaaatttttgcgattttttcagatctcctggcattttgatctcaaatcgctcaaaaaatcgattgaaaaaattgaaattcgtatggcgggaattcaaaaattcgaaaaaggaaaagcgatggcgattgcctgtctgggagatgtaagcctaaaattatcgtttttttttaaatttatcgattttttcgaaaattatcgattttttcccaattttcagagttgtatgagactccccatcgattgctcagcgctaacaattgaagacccgaaaaatgctgaaattctgaagattactgtaggtttttttttcagaaaatctaaaaaatcgataatttttccaggcaacactatccggcggtgagggcgcaatcggcttccagcaggctcaaattttcagaaccgagcttaagcgtggcggaggagcaagaactgaaagcttttcggtcaaaatttggatgaaaaattaagaaaattaaattaatgctttttttcgttttaaattatttttattgtgatgatttttaaatgtaaattttaaaataaaatgggtttacttggaggaaa