Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E10A_156.a   

sjj_Y54E10A_156.a RNAi JA:Y54E10A_156.a
Simmer:Y54E10A_156.a:Screen_A
Simmer:Y54E10A_156.a:Screen_B
PCR_productsjj_Y54E10A_156.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y54E10A.15a Source_evidenceePCR1222WS150 Sequence/Annotation Release
Y54E10A.15b Source_evidenceePCR1222WS150 Sequence/Annotation Release
Overlaps_Gene Y54E10A.15 Source_evidenceePCR1222WS150 Sequence/Annotation Release
Chunk_score Abs_score1159
Max_abs_score1159Y54E10A.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI32255363227929
Overlaps_transcript Y54E10A.15a Source_evidenceePCR1222WS150 Sequence/Annotation Release
Y54E10A.15b Source_evidenceePCR1222WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E10A_156.a2394tatgacatttcgtgacaatcgaggccaacttataacggaaaacatgagctcggtctctttgacgagcagcgtccaggcgaatcctcccgtcgacttctggctttcggagagccggttgaacttgttttctggggcttttctttggggagagcagctttgatgggcagactagtggaagatcttcggtgtcgccgtcggtgggggatttttcgtaaatgtagcctcgtagatctgcaaaaaaaaaggttttttgtaagcaggaaacttttttttgactaaaaattggggttttttcgaattttataactaaaaaattgcgtttttctgggattttttgaacaaaaaaaggtgtttttttcaatgtttggccacaaagattgtgtttttctcagatattttaaactaaaatattgcgtatttttcgcatttatgactaaaaaattgcgtttttttcggatttttgaacaagaaaggtgttttttcgtatttttttgactaaagaaatgtgtctttttttttcgatttttcgacttaaaattgtgttttttccagattttttaaattaaaaataattgtttttttctaattttttgaacaaaaaatggtgttttttccaatttataaatagcgttgtttcggattatttgactgaaatattgtgtttttttttcggattttttgaataaaaattcggtattttcggttttttttacaaaaaacgctgttctatcggattttatgactaaaaaattgagctctttcggattttttgaataaagaattatcttttttccgattttatgactaaaaaacggtgtttttttcccggatttttttcttaaaattgagttttttcgaatttttttactaaaaaattgttttttttttggattttttaaacaaaaaagtttttttttcgaacatctggtaaaaagctgtgttttttcttactttttgaagagaaaattgtgttttttttcagtttttttttgagcaaagctagtatttttagaatttccaaaaattaatataaaaccagggctttttttttgaattttttgaaaaattttcacatcaaaaatcagtatcaggagcatgaatagggtctgttaaaaaatagagaaatattttattaatcgttaaatattttcgagttcaaaaatgtgtggaggtgatcaaacagagaagaaaaatcgataagtctttttaaacttaaaagaatgctattttacgattaatataatattttttctattttctgacactaaattttaatggaatacgtcagaaatagctgattttttaaatgtttttattgcaaattgccaaccgaaagctacgaaccttccacgagattcggtcgaacctcaagttcatacttcccgccctggccgaatgcttttcgctgttcacgcatctcaatatgatatgattgaggatatacatgaagaatttgtgacaaatgttcattggaaaaatcctttccagacgtattcttaacattcttgatcaactcaggaaccacacagcttcgattctgaccgataaagatcgcagtgatctgatcgattcgtttgaaagtatcagcgagatgttcatacgcagttggaagttcaatccgttgacgtgcactctccttaacttcatcaataagccgtgagctcttcagaaactctgcagtcattcgttttccctcttcttcgtgagcatcatcctgctctccgcgaactttttcggccgatttcaggacattaaagccgggaataatatagtctggaactggcttcttcggtgagaacagattacgagcggccttggatttctgaggtgatttgtgatgctcaacaataactggtttcttcggagatttcagcaattccacgtgatcatcgacctgcttcgttttgttcttcaaattttgctcatgaatcgctttagctgctccttttgcagctattcttgcttgtaaatctgcaacagttcgaattccagccttctttttcgctgggccggatgcttccattagcttatcgatcgctgacttctgaggagccggattttccagaataatatcttcatggattttgggaagctcaggggcttctgcttcagcttctctagctttttttggcggagttccggaactcgataattccgcttgacgggatggagtccgagcgcgagttcgggaggatttattctcgacgattggagcagcaggaatttgtacttctttaattgtagtggtctttgtgatgctttcatcgataatcttcttttctcctcttgctctcggttttctggtggtctgaaaaagaaaaaaaaacattaaataattgcaattcataacttcaaactccaatttaccttgaaaaagtcggttacagcagtctg