Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E10B_152.b   

sjj_Y54E10B_152.bRNAiJA:Y54E10B_152.b
PCR_productsjj_Y54E10B_152.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y54E10BL.1 Source_evidenceePCR273WS150 Sequence/Annotation Release
Y54E10BL.2 Source_evidenceePCR758WS150 Sequence/Annotation Release
Y54E10BL.6 Source_evidenceePCR381WS150 Sequence/Annotation Release
Overlaps_Gene (14)
Overlaps_transcript Y54E10BL.2 Source_evidenceePCR799WS150 Sequence/Annotation Release
Y54E10BL.1 Source_evidenceePCR330WS150 Sequence/Annotation Release
Y54E10BL.6 Source_evidenceePCR381WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E10B_152.b2490tattccactatgtgcagacccttcaagcttccgtacaaggagaggttgagtactgcaagtcccgatctcgggatatgtggcgtgagatggtcgaggttgcaccggaaggtgctgatgatccacttgatgttctgctcagagctacacgtcaagctgatgctcaatgctgcacatgccaacagggaccaccaggaccagatggagagccaggaactcctggaaaagacggagaaccaggtcaaggaccaggagagccaggaccaccaggacctgatgccgagcttcatgatcgaattctcccggttccaccacaatgcccatgcactgctgctccaggacttggaggaccaccaggaccaccaggacaagatggaattccaggtaacccgggaagaaacggagaggatggagctccaggaccacaaggaccatccggaccaccgggaccacctgggcaaccaggacagcctggacaacgcggaccaccaggagagcctggagcacttcttccaggaggagacgctccaccaggcccatccggaccaccaggacggccaggagcaccaggacagccaggaaaggccggatctccaggacaagacggaagcaacggagacgccggagttgctggagagccaggtaaattatcatgataagctaggcttcttcttcttcttctaaacgttaaatttgtttcaggacaacgcggaccaccaggaccaccaggacaagccggaactccaggatcgccaggagacgccggatctccaggatcgtgcgagcactgcccaccagcacgtcttgctccaggatattagaagcttatgcgagtctgtctgtacattttcgaataaactatattattttttcaatcgatatgtcgtagttgtccatttaataaaaaaaagggtgaagaggcttgtgaagcacggtgagctcaggtatcgccaggaacctctggaaagagaactaggtcaagaaccaggagagcaccgtgagcttctgttggaggtattgggggagcacaggagagcctggagtgcttcttccagaaggagacactccagcaaacccaactaggccatcaagacggacaggaggctcacggcatcctggaaagggcagatctccaggacaagacggaagaagttgagacgtcggagcacgtggtgccaggctgccccgttttggtttgatctaccgagatctacaaaaaatgcgggagtcgagacgaagaattttcagctgacgtcacattttttggggaaaaaattgccgcattttttgtaggtcaaaccgtaatgggacagcggacagacaccacgtacggagttgctggagagcagggtgagccaaagatttcgtttaaaaatccagaatgacgagctttttattggacgatcttctgaatatgttcagccaggaacctctggaaagacggacttccaggtgctgggaagaaggacggagcttcaggatcacaaggatcatccggaccatcggcagagcctggagcacttctcccaggaggagggcaagccgaataccaggattgtgcgagcactgcccaccagcgagctcagggaccgccaggaaccatagaaaagtcggagaatcaggtgatccaggatcaccaggacgagcttcgtgattgaactctcccgattccgccataatgcccgtgagcttctggaccacaggagagcctggagaacttcttccagaaggaaacgctccagcaagcccaccaggacatccgggaaagagcagatctccaggacaagacggaagcaattgagacgccggagttcgatcttctgaacaggatccgccaggaacctctggaaagacggaattccaggtaccgggaagaaggtcggagcttcaggatcacaaggatcattcggaccatcggcagagccaggtactccgagtagaagcttggtcagatcgacaatgcggatcacaaggacaagccgaatccgagaatcctgcgagaactgtccaccatatcattttccaacatacccgcacattttccaataaactattacctttttcaaaactatatcaagtgaaagcccatccatatactccatacaaattgatatatcgttattgtccacaaaagccccgtagaatccaacaatgaatggactattgcacttgtgaagtacggcgagctctttgacgatctgttgtcggactgacggcttgatctcgaggtgtacaagcttccgagccataattacaccggtttttcgatgaacacactgaaaaattgaactttttatttccaaattccagcttatttcagcaaattccaaccttattaacaactcctccatttccatggccaagttctccttcagtctgtagcatatcctcactcaactccttgatgccctccttgacctgcaagaattcgctgagccgttgagtttgtggctccgtgagcccgagctttttcagctgttcttctagtgggac