Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E10B_152.d   

sjj_Y54E10B_152.dRNAiJA:Y54E10B_152.d
PCR_productsjj_Y54E10B_152.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY54E10BL.2 Source_evidenceePCR858WS150 Sequence/Annotation Release
Overlaps_Gene (12)
Overlaps_transcriptY54E10BL.2 Source_evidenceePCR888WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E10B_152.d1599aactgatttcgcatggttaagaacgtgctgacgtcacattggggaaaaattgccgcattttttgtagatcaaatcgtgatgggacagcctagcctggcaccacgtgcaggcaggtgtcgccttcaaatcaggcaggtaggtgtttcaacgccgacatggaagccctagactttctatacggaatcttttaaaaactacattatttaactgtcctgaaagagtagaaaactcatttacagcgccgaaactcgattattggcttttcgaagtcccaaaacttccagccgaactgctcttcgattccttcccctactttttccacaccttgatactttatgtgtcatcataatcaacagtcatgtacaacaacgggcggagaagatgaggaaatcgaaaaaaaaaacgcaagggatgttcactgcgcggggcgcacggaaattgcgtgcgcaacgatgagacgcagcgcacacagaagtgcgcgacttgccgtttcgttccaccacagcggccgcatataagcactcgggggcaacggcaaatgactgtgtaggcttcttcttcttattcttttgacacttctgacatttttcatttcccttcttcacctttgattctttgttcgaatattctagaaaattcatagaatttcagatggacgagaagagcaagggatcgttgcgaagtgtggcgttcgtcgccgtcacattctccacagtcgcagtgactgctgtgcttatcgctttcccattggtattccactatgtgcagacccttcaagcttccgtacaaggagaggttgagtactgcaagtcccgatctcgggatatgtggcgtgagatggtcgaggttgcaccggaaggtgctgatgatccacttgatgttctgctcagagctacacgtcaagctgatgctcaatgctgcacatgccaacagggaccaccaggaccagatggagagccaggaactcctggaaaagacggagaaccaggtcaaggaccaggagagccaggaccaccaggacctgatgccgagcttcatgatcgaattctcccggttccaccacaatgcccatgcactgctgctccaggacttggaggaccaccaggaccaccaggacaagatggaattccaggtaacccgggaagaaacggagaggatggagctccaggaccacaaggaccatccggaccaccgggaccacctgggcaaccaggacagcctggacaacgcggaccaccaggagagcctggagcacttcttccaggaggagacgctccaccaggcccatccggaccaccaggacggccaggagcaccaggacagccaggaaaggccggatctccaggacaagacggaagcaacggagacgccggagttgctggagagccaggtaaattatcatgataagctaggcttcttcttcttcttctaaacgttaaatttgtttcaggacaacgcggaccaccaggaccaccaggacaagccggaactccaggatcgccaggagacgccggatctccaggatcgtgcgagcactgcccaccagcacgtcttgctccaggatattagaagcttatgcgagtctgtctgtacattttc