Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E10B_152.e   

sjj_Y54E10B_152.eRNAiJA:Y54E10B_152.e
PCR_productsjj_Y54E10B_152.e
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y54E10BL.1 Source_evidenceePCR273WS150 Sequence/Annotation Release
Y54E10BL.6 Source_evidenceePCR219WS150 Sequence/Annotation Release
Overlaps_Gene Y54E10BL.1 Source_evidenceePCR330WS150 Sequence/Annotation Release
Chunk_score Abs_score309
Max_abs_score309Y54E10BL.1
Specificity_index0.607
Rel_score1
Map_statusBest_ePCRI30120283013075
Y54E10BL.6 Source_evidenceePCR219WS150 Sequence/Annotation Release
Chunk_score Abs_score200
Specificity_index0.393
Rel_score0.647
Map_statusTop50_percentile_ePCRI30120283013075
Overlaps_transcript Y54E10BL.1 Source_evidenceePCR330WS150 Sequence/Annotation Release
Y54E10BL.6 Source_evidenceePCR219WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E10B_152.e1048attttcagctgacgtcacattttttggggaaaaaattgccgcattttttgtaggtcaaaccgtaatgggacagcggacagacaccacgtacggagttgctggagagcagggtgagccaaagatttcgtttaaaaatccagaatgacgagctttttattggacgatcttctgaatatgttcagccaggaacctctggaaagacggacttccaggtgctgggaagaaggacggagcttcaggatcacaaggatcatccggaccatcggcagagcctggagcacttctcccaggaggagggcaagccgaataccaggattgtgcgagcactgcccaccagcgagctcagggaccgccaggaaccatagaaaagtcggagaatcaggtgatccaggatcaccaggacgagcttcgtgattgaactctcccgattccgccataatgcccgtgagcttctggaccacaggagagcctggagaacttcttccagaaggaaacgctccagcaagcccaccaggacatccgggaaagagcagatctccaggacaagacggaagcaattgagacgccggagttcgatcttctgaacaggatccgccaggaacctctggaaagacggaattccaggtaccgggaagaaggtcggagcttcaggatcacaaggatcattcggaccatcggcagagccaggtactccgagtagaagcttggtcagatcgacaatgcggatcacaaggacaagccgaatccgagaatcctgcgagaactgtccaccatatcattttccaacatacccgcacattttccaataaactattacctttttcaaaactatatcaagtgaaagcccatccatatactccatacaaattgatatatcgttattgtccacaaaagccccgtagaatccaacaatgaatggactattgcacttgtgaagtacggcgagctctttgacgatctgttgtcggactgacggcttgatctcgaggtgtacaagcttccgagccataattacaccggtttttcgatgaacacactgaaaaattga