Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E10B_159.c   

sjj_Y54E10B_159.c RNAi JA:Y54E10B_159.c
Simmer:Y54E10B_159.c:Screen_A
Simmer:Y54E10B_159.c:Screen_B
PCR_productsjj_Y54E10B_159.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY54E10BR.6 Source_evidenceePCR594WS150 Sequence/Annotation Release
Overlaps_Gene Y54E10BR.6 Source_evidenceePCR622WS150 Sequence/Annotation Release
Chunk_score Abs_score580
Max_abs_score580Y54E10BR.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI30313113032965
Overlaps_transcriptY54E10BR.6 Source_evidenceePCR622WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E10B_159.c1655atgatacagcgaatcgttgaaaaccagatcattccgcttggcacagtccgagaaaatcgtccatcaaggttccgatggcaaaaatgtcgttagcatcgacacgtgttccgatgagcttcacacggatctcatcatcattccgaatcacattcgcctcatcattggtcttgtagcacggtttctcactgttcggatcgaattccatgtctggtggaatacaatgacgactgatgaagcatgaaagtggtccgatatcacagaaaatgccgactttattgacctgtgtgacgactccatcgacgacttgtcctttgaacgggcggaacacgatggccttgtaacggaccgggtagatgacgaatccacggccaggctggatcaggccgtggccgatcgtgtcgattgtggtgactgcgatgacgaatccgtactttcctgtgcacgttccctcgacttcgttgaacagcttcattttgatggtttcgttcaggtttggaccgaaatatttcggatggaggcagacttcatggtcgagtgacaagtggaagaacatctgaaagttcttaaatttgtatttaaaagaggaaatcgtaacggttctgggttttttagtgattttttttggtttaaaactcaaatttctatcgatttttgcatgtaaactctgtgtttcaagcataaaaatcgttttttaaaatttaatttttactattaaaacaggagtaatttttaacgttgaagatccaaaatgtgctcaaatggacgaatttcgtaatgaaatttctcaaaattccgaaaaacccggctaagttcacttgttcagtaagcccgttcagaatatacccagatttaaaccaaattaaaaccgtacaagcctatattgtgaatttatctgcacaaatttggtttggatctacacaaacctacacaaattcagtttacatctactcaaacttgcaatctatgcaaattatgtttgaatctagacaatcttggtttacatctgcccaaaattagaatttttcataatataggcttgtacggtttaaatctgggtatattctgaacgggtttactgagtggaatagcgaaatttggccacttttccgcgtcgcggcgatggaaagttcacttttttttaaattatcatcctttattgcttaaaaacgtgagataatcgatcaaattatgcaaaaagagatgaaaattccaaaaaagtccacttccaatcgctgcgacatggaaagtagccagaattggagattttacccgacataaaaaatgttcgagcactctttaagaatttttattgcaaaattcgcttatttgagcatatttcggtcttatacattcaaaatacctagaatctttactcctaaaagttaaaaacccccttagagaaattttatgcacgaattctggattttacacacaaaaaatcgatttctgatcaagtatttattgcgtaaaacaagaaaattgagttttaaaaccaaaaaaaaacaattaaaaacgaaaaaatccaccaaaatctattcgaaaaataaataaatttcgtacacgaagcgtaagcgcaccagttgcgtgccaacgagacgaagaatgcgccagcaggcgtccttggcgcatatctcgtttttcttttattttgccaa