Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E5A.2   

sjj_Y54E5A.2RNAiJA:Y54E5A.2
PCR_productsjj_Y54E5A.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY54E5A.2 Source_evidenceePCR594WS150 Sequence/Annotation Release
Overlaps_Gene Y54E5A.2 Source_evidenceePCR594WS150 Sequence/Annotation Release
Chunk_score Abs_score531
Max_abs_score531Y54E5A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1469415214695833
Overlaps_transcriptY54E5A.2 Source_evidenceePCR594WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E5A.21682ccatggttttgttgttcaattttctgaaacttatgcttttttcgacagtgcatggaattgttatcgagtttggtaaggagacctcttcgctggagcgcgtttgcagcccctttctgcaaagtctcaaatctactgtttttttttcagaaagacgagcggaactctactccctgtactcctcaattccattatcaaaagacacgtggagatttgagaattacctgaacgttcacaagtacaacaatatactattcgacggaaaaatcttggaattcgactcactgggatggttaaatgggaatcagacgatttatcacaaattaccatattttatatcgaatccggcgtttcgaattcctcatatatcaaaggaattgtgtgattctaacgggttctttaatattggatttcgcatttttcaggtttaatttttttttctatttattcgataatttttatataatattgttgaattttagcttttcgggcctaaaaatctataaaaacggcaaaagttcggtggagcgcgtttgcacactcgcgaatcgtgccaagaccagttttaatcaatttttaagatcatagacaaatgcagctgtttttctgctagattttatatgtttctagtgagcaaattcatttcatgagcaaaagagaaaaaaaaatgattaaaataaatttggtgaagcgcacttttacacgtggtgtcaggcgttttccataaagttttgtagattttagtgttaaagttcaaaatttagacatgttatagaggcgtagcgtaaatttgaatgatctacaataaaatgcggaaattttttgcccagtaaaatgtgtcgccagcacacttacaaaatttgttgagaaatctgcgactcaattcccgcattttttgaagatcacaccgaaatgggacactctgaccacgtgttttattatcttttgcgggcttattcacatgaaaaaaaccgttttttttctataaaattttgtagatttgagtgtaaaagttcaaaatttagacctgttataggggcggagcgtaaattttcaattgtttttcccgcccctttttttttgagatcgccttcccccgatatttaaattctccagaaaacgctgcccctgcatcaaaatcaacgttattttgcagaaaactcgcgaagcgggcctcccgtaccaaccgcaatgtgccacgtgtcatccgataattgaaggtctccatcaaatgtactacgtattcccggaacgtgatttcactcagattttcacgaaattgacgatcggctctcgaaaaatcaataatttattgcactattgtagtcgggaggattgtgaacaggagccacgtgtctcgaattttcaggattacttgagaattaatagtgagtgtattatttaacttggctgaaaattagacgaactagctgaaattaccctcaaagtatcagaaatttatttctgaattcaatgagtctagttaagcatagcatacatatcacaagccttcattatctctcaagggtactcctaaggtgcttagtaggtacagtgcacccaacagctacttttttatagaaaactagtattggaattggaatcagcataccaaaaaacctatggatctataattttatcatgatatctcaaaagttgagtgcaaaagagcaaaaagttgaaaa