Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y54E5B.3   

sjj_Y54E5B.3 RNAi JA:Y54E5B.3
Simmer:Y54E5B.3:Screen_A
Simmer:Y54E5B.3:Screen_B
PCR_productsjj_Y54E5B.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y54E5B.3a Source_evidenceePCR713WS150 Sequence/Annotation Release
Y54E5B.3b Source_evidenceePCR707WS150 Sequence/Annotation Release
Overlaps_Gene Y54E5B.3 Source_evidenceePCR713WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI1482040714821476
Overlaps_transcript Y54E5B.3b Source_evidenceePCR707WS150 Sequence/Annotation Release
Y54E5B.3a Source_evidenceePCR713WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y54E5B.31070aatgcttcctggttttggtgcacaaacagtcagcccgttcccaaatcctccagagtacgcatcggcgtatacaagtgatcgaatcaataatggtaaggagtttgaattttgaaattttgaaactagcagtttttaattcagcaaacagtatttttttttgttagaaataaaacgcaatttctctaacagatttctcatacatcactttaacaagattcaggttcggcaccacctccgccgcatccacttacggaattcaaggtgtacggagaggaatatcgattggaagatgatgtcatcgcgtaagaaattttagcggctatataaaaaccaaaaacatgctgagtctagccgaattttcccacctattttgcaaaaacctttttcaatacgcgggaaaaactagaataaaacattcatttacagccctctgaaaaacgccggtgttgctgagctctacaagaacaaaaataattggaaaaccgagatgaagaagttgaacaggtccgccatagtcgcatttttcgatttggtcgaaattctgattcgcgctcccgatcacccaatgagagaggagaaaatggtcgatttacacacgatattcattaatatgcatcatttgatcaatgaattccggccagttcaggtagaaaagtgttttaaaaatgaaataaaatctatatttttctatgtttttcaggctcgcgacagtgttcgaattttacaagagagacaaatcgaagaattatcggatatttgcaaggattttaagttagtcaaatcggaattaagttttaaatttgtatattttttctccttttttccagaaaatatctgcgtgatggtcgagaagttgtcgatgaccaattccaaatgatccgtgggaagcttccagctccacctcaaccttcggaactgacacgtgtcaaactgcaagacggagtgcttcatatgcttcaggagacagaagcttcagatgacgtggaaatgaaagaggaagaaggatcggaatatagtaaaaagaaagcgaggctggaactattatcaagagaagatggaccaccgagtgt