Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y55F3A_750.c   

sjj_Y55F3A_750.c RNAi JA:Y55F3A_750.c
Simmer:Y55F3A_750.c
PCR_productsjj_Y55F3A_750.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY55F3AR.3 Source_evidenceePCR157WS150 Sequence/Annotation Release
Overlaps_Gene Y55F3AR.3 Source_evidenceePCR164WS150 Sequence/Annotation Release
Chunk_score Abs_score155
Max_abs_score155Y55F3AR.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV10936951094103
Overlaps_transcriptY55F3AR.3 Source_evidenceePCR164WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y55F3A_750.c409tgttcattcctaaagtgggaaaattggggaaaaatcatatatttaatgtgaaattctgcaattttccgtaccatttggtccgtaggccgatcgaatctgcgaagcgagctccgtacaggcctcgatattcctctgaacagcctcgtcggttcctttgaagtgctgagctccttccttcatgaaccggttgtaaccggactttgggatcttcatagccatgatttacctgcaaattattagattttaggggcaaaatcgaaaaattgtgtaaaaattgagtaagaatgagcaattttaggtgaagttttagagattttggtctaaattttaggatttttagattgttagttgttttttcagcttgaaaacttcagaaaataatataaatacggcaaaattcactttgaga