Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y55F3A_750.c_b   

sjj_Y55F3A_750.c_bSequenceTCTCAAAGTGAATTTTGCCGTAT
PCR_productsjj_Y55F3A_750.c