Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y56A3A.19   

sjj_Y56A3A.19 RNAi JA:Y56A3A.19
Simmer:Y56A3A.19
PCR_productsjj_Y56A3A.19
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY56A3A.19 Source_evidenceePCR402WS150 Sequence/Annotation Release
Overlaps_Gene Y56A3A.19 Source_evidenceePCR508WS150 Sequence/Annotation Release
Chunk_score Abs_score466
Max_abs_score466Y56A3A.19
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1191492011915598
Overlaps_transcriptY56A3A.19 Source_evidenceePCR508WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y56A3A.19679aaaagcggctaccataaactttcgcgtcgagacccctaaatctgtgcgcctttgagaaaagtatatcagaaagaaattaactttttatcaacgcgaaaattattaaatgaatttcaaacttttatttttgaaaaaaaatccgaaaaacaaaaaaaaatgataatagaaaatatttctactgcagctaaaaagataaagaaatacaaaaattattcgaaaacgtcttccttgtcggcgatgtactggaagatgtcgcgtggcgtcttgaagcgatccgcatctccgtcgggaatctcgaatccaaactcttcctccatcgccatcacaacttctacgtgatccagagagtcgaggccgagatctttcgagaaatccgagtccattgtgagcttcttcgcgtcgattttgtcgtagagtgagagaaccaacacaattcgctcctcgagtgtctttttggtcagtggagcctggaaaatgttgttttctttttgcgaaaaaatattttttttttgttaattcccacctttgcagagtattgtctgatttggaagcttggtttctgtgcggagaggagtattggggtgatgactcgttgttggacggacgcattgctcagtgcacgcactgaaacagtgcggagagcagcggaaacggcgactcgcaacatttctgaacaaat