Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y57A10B.1   

sjj_Y57A10B.1 RNAi JA:Y57A10B.1
[cgc5655]:Y57A10B.1
PCR_productsjj_Y57A10B.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY57A10B.1 Source_evidenceePCR737WS150 Sequence/Annotation Release
Overlaps_Gene Y57A10B.1 Source_evidenceePCR737WS150 Sequence/Annotation Release
Chunk_score Abs_score590
Max_abs_score590Y57A10B.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1236041612362679
Overlaps_transcriptY57A10B.1 Source_evidenceePCR737WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y57A10B.12264tctagattcgaactccagcaaagtgtcaaatatccgcaaaatgaaagacccgactgaaaaagtgaactttttttcaaagaccgaatttactgcgacaaaaatgcaaaaattatcacaaaatccatgaaaaattaccgtttaaaaatgtattctattcaaatttttgttgttgttttttttttcaattttgaaaaattccgtccttatgacccattttctattatttaaagcaagtagtttttactaaagtttttttccaaaattatgtcggctgcttcccaattcccattaagctttcatacctttcatttatccgaaaatttttattcaatttctcatttttctccatgattggagatgaatatgcaaaaaaggtgatggaggcccgcgcgcgcggggaaaagggaatcggtaattagaaagaaccagtcaccgtaattacaggttgttagacggtaaaaggttgtaagaaataaggaaaacaacaatgtgtgaaattttgggggatttagaaattttaaaaaaattgattttcgtacctaaaaatttgttttgcaaattttttatttttttcatactcaatcaaaataataaaaaaaaaccattttgttctaaaaattaaaaatttgaattcccgccaaaaattttcaaattaaattttgaatattcacgggggtctggccttccttattgcatttttcgcgctccattgacaatcgcccgccggactggcaaagccgtgtactccacacggacaaatacatttagttttacaactaaagtcgagccgcgacgcgacacgcaacgcgccgtaaatctaccccagatatggcctggcctagttcggcaaactattccatatcaatttattagggaagcctgaaatccgtgaatattccgctgaatgtaaatttattttagaattttccagtactcatacatacaaattgtgaccacattcaattagaaaagtatgaaaatttgaaaaaaaccttaaaccagactccgcccatataatggccttctacttaccttaacatgagcatacattgcaaggaaaaagctaaggaaaaacaccatcgccgcgatcagcgtcaccgttgacaatacattttcggcttcttctcgccgataagactcgtcttttgttgaggcattaaccgttatatcacctggaaaaatattaataaaatcttcttttattaaagctgttttagctgctgagttatagctatttaaatctatataattaggaaagtgatccaaaaattcaaatttgaaggttcacccttccctttttcaaaaaaaaactcaccaattcgtttcctggcacctaacaccactgtcggtactgatgattcttctgaagccgtcgctactgctgtgagagacggcggagcggccggaggtacatcactcactacgccttccacgtttagtggttgagtactgaaaaataaaactatttacacgagctggggttcgaactttgatgatcagattggtaggcgtgtgtgctaccagttgagctatagcgcccgtgcaggcgtggctcgaaaaaaagacggaacttaccgattcctaagctcgccttgcgacgacgataacccgtagctcttctcgagctgaaaacagacgacagtggagaatgcggataatatcatgagaacaattgcgacgacgaagagtgtgtagaagcgaatgtcggcttgcgcacactgtggaagcttcatttcgcggtactataaagttttttagattttttagagtgagtatgatacagtagttagatttactttaagcacccgacgtcttcgatatttatagaggcatagttcgcatattgcaggccgatgcagctttctcgacgaaatgtcgagccagtgctggaaatgtaccgtattcttttcatgacatgtaggagacggcgaattttgtgccgccatagctcagtcggttagagcgtgggtctaataagcccaaggtcgcaggttcgacccctgctggcggcaaaatttttattttcctaattcttcttttttcactttacttcccaaaaaaaccattttcaatttcattttctggttgaaaaccgaaatccgaggactaaccattaaacacgacacatgtacatattgcaaagatccagaacatctacaaggagaaatcagcggatcatttgagtctggaggccaacagcaatgacaaatcctacataaaggctcgttcgacatgtcagaacgtgccaatgagtatacagatga