Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y57E12_247.a   

sjj_Y57E12_247.aRNAiJA:Y57E12_247.a
PCR_productsjj_Y57E12_247.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12B5.6 Source_evidenceePCR471WS150 Sequence/Annotation Release
Overlaps_Gene (7)
Overlaps_transcriptT12B5.6 Source_evidenceePCR471WS150 Sequence/Annotation Release
Overlaps_pseudogene Y57E12AL.3 Source_evidenceePCR471WS150 Sequence/Annotation Release
Map_statusTop85_percentile_ePCRV70595147059984
D1054.4 Source_evidenceePCR471WS150 Sequence/Annotation Release
Map_statusTop85_percentile_ePCRV1077665510777125
Y68A4A.4 Source_evidenceePCR472WS150 Sequence/Annotation Release
Map_statusBest_ePCRV1719798717198458
H28G03.5 Source_evidenceePCR471WS150 Sequence/Annotation Release
Map_statusTop85_percentile_ePCRX52327355233205
WB_DNA_textsjj_Y57E12_247.a471tcgagacgttagattgcttcttctttatgaatttcgtcttggtcattcagcaatggaagcggaacgaaacatatgcggtgcgatgggtgagggagcactctcttataatacagcaaagagttggtttcaaaagttcaagaacggcgacttcagtctcgaagaaatagaacgttctgggcgaccggtagagttaaatgaagaagacctagtgaagctggtggaggaagagcctcgtcttagtcttcgtgaaatggaagagaagcttgagtgttgtcatagcacaattgcacgtcacttgggtcgccttggttttacttcaaaacttggaatttgggtgcctcatgaactttcggcatcacagaagctcactcgggtcaacgtttgtactcaacttctaacttttcgtcgaaagttcgattggctgaacaatctggttactggagatgagaagtgggtgctctatgttaacca