Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y57G11C.12   

sjj_Y57G11C.12 RNAi (2)
PCR_productsjj_Y57G11C.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y57G11C.12 Source_evidenceePCR655WS150 Sequence/Annotation Release
Chunk_score Abs_score529
Max_abs_score529Y57G11C.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1479649214797396
Overlaps_transcript Y57G11C.12.2 Source_evidenceePCR655WS150 Sequence/Annotation Release
Y57G11C.12.4 Source_evidenceePCR580WS150 Sequence/Annotation Release
Y57G11C.12.3 Source_evidenceePCR546WS150 Sequence/Annotation Release
Y57G11C.12.1 Source_evidenceePCR595WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y57G11C.12905gttgaggaatttggagaggaagtcctttggcttggcttcgacattttcagcgaacaggtagttgcgcacgtgatccgggttgtagaatgcgtaacggatcgatttcatgtgctgaaagtgacaattagagtttagaaaatttaaattttattcaaaaacctgatgagtttctccgacaagtctgtcaacgacacgaacatcggtgagatgtccgttctttgtgaattgcttcttgatgacagcacggaacacgccgagcggcatatcatgaagtccgaaatcccaccagaactttggagtgagacgttggaactccttataagcggcgagaaccgacatgcgtgcctcggcggaattgttggatttgattggagcgacggtgcgaacggcgtgttgtccggcacggacgactcttccggcagttgcagacattattacgaaagagtatctcctttggtgacacgggcttcaagaaattcgacctttcgttccaaaaggttaagcttgtcgctgagagtcgctagttttgtgcggcaagagagctctggaagaaatcagatattttttaaaggaattaatttaaaataataatttttctacaaaccaaagctggacaagaagttagcgatgttcttgatgttatcggcaataatctgaaagttagtacgggttagtgtgggagatatgaattcacacatgaatatttgttgtaaaattgtataaaatcacaacctactgaagtgaaaagctatttcaacaccgcagttaaaaatattcaaaaatttcaacaaccatttttaatcaattttcattcacatttcaatcgatttccatcatttttttccgtctactaacctgctcaaactcgcgattatcccagtcgtcctttagttgttgttgaacgg