Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y57G11C.18   

sjj_Y57G11C.18RNAiJA:Y57G11C.18
PCR_productsjj_Y57G11C.18
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F54H12.4 Source_evidenceePCR767WS150 Sequence/Annotation Release
Y57G11C.18 Source_evidenceePCR767WS150 Sequence/Annotation Release
Overlaps_Gene F54H12.4 Source_evidenceePCR767WS150 Sequence/Annotation Release
Chunk_score Abs_score499
Specificity_index0.408
Rel_score0.688
Map_statusBest_ePCRIII79617857962717
Y57G11C.18 Source_evidenceePCR767WS150 Sequence/Annotation Release
Chunk_score Abs_score725
Max_abs_score725Y57G11C.18
Specificity_index0.592
Rel_score1
Map_statusBest_ePCRIV1484053714841469
Overlaps_transcript F54H12.4 Source_evidenceePCR767WS150 Sequence/Annotation Release
Y57G11C.18 Source_evidenceePCR767WS150 Sequence/Annotation Release
WB_DNA_text sjj_Y57G11C.18_1933tcagtgttttgtggcgtctcatcaaccatcggctcttcatcttcatcttcctcatccagctgcaatttataaagttttcgcggtttcacgttattcatgctctttcctctcttgagatcaaacttttgcctcttgtttgaagtggcgtattgctgaaacgatcgttttttaattgaaactggtgtaatttccacagttttttcctcaggtttcctcggtggagcggcttgcatatcttgatcgggttcttcaatcttcactttcaccacactcttcttttcctttttacccaaaggtctactgagagttccgtctttcttttgtttcttggacttttttatttttccgggtgcatgtttttggggttccataaaaagttcatttacattttgctccatatttatttctggaattttttcgtattccatatgataatcctcatcctcgggctcttctttgatgtaaacgtttttgcggggctttaaatgatttattccatcattgtggtacgtcacgtcatcaaacaattgttcattttccgctttataaacaggaggactttcataatatttttcttgatatgattctctcttttcaggaatgacttcatattttaaattacgtctctctagcttcacatttcttttttgattgtcattctgttgttgtaaattttcttgaataacatcaaataattcttcagtgacaattggtagttcagggtggttacgaattcgatatagtacatcttgataaaaacggcattttgtagttggatcaacatctgatgcggataggatattttctaaaaaacgtttggcagattcatattcagacccattctcgtagggtatcatgtgatatttgcgaatcaacttcatttccagagatttgtcgcaataagtgaaggaataacaagcgtagccaattgct
sjj_Y57G11C.18_2933tcagtgttttgtggcgtctcatcaaccatcggctcttcatcttcatcttcctcatccagctgcattttataaagttttcgcggtttcacgttattcatgctctttcctctcttgagatcaaacttttgcctcttgtttgaagtggcgtcttgctgaaacgatcgttttttaattgaaactggtgcggtttcctcatttttttcctcaggtttcctcggtggagcggcttgcatatcttgatcgggttcttcaattttcactttcaccacactcttattttcctttttacccaaaggtctactgagagttccgtctttcttttgattcttggacttttttatttttccggctgcatgtttttggggttccgtaaaaagttcatttacattttgctccatatttatttctggaattttttcgtattccatatgataatcctcatcctcgggctcttctttgatgtaaacgtttttgcggggctttaaatgatttattccatcattgcggtacggcacgtcatcaaacaattgttcattttccgctttataaacaggaggattcgtataatctttttcttgatatgattctctcttttcaggaatgacttcatattttaaattacgcctctctagcttcacatttctcttttgattgtcattctgttgttgtaaattttcttgaacaacatcaaataattcttcagtgacaattggtagttcagggtggttacgaattcgatatagtacatcttgataaaaacggcattttgtagttggatcaacatctgatgcggataggatattttctaaaaaacgtttggcagattcatattcagacccattctcgtagggtatcatgtgatatttgcgaatcaacttcatttccagagatttgttgcaatgagtgaaggaataacaagcgtagccaattgct
sjj_Y57G11C.18_3942agcaattggctacgcttgttattccttcacttattgcaacaaatctctggaaatgaagttgattcgcaaatatcacatgataccctacgagaatgggtctgcatatgaatctgccaagcgttttttatccgcatcagatgttgatccaactacaaagtgccgtttttaccaagatgtattataccgcatccgaaaccaccctgaactaccaattgtcactgacgaattatttgatgttgttcaagaaaatttacaacaacagaatgacaatcaaaagagaaatgtgaagctagagagacgtaatttaaaatatgaagccattcctgaaaagagagaatcatatcaagaaaaagattataggaatcctcctgtttataaagcggaaaatgaacaattgtttgatgacgtgccgaaccacaatgatggaataaatcatttaaagcccctcaaaaacgtttacatcaaagaagagcccgaggatgaggattatcatatggaatacgaaaaaattccaaaaataaatatggagcaaaataatgtaaatgaactttttacggaaccacaaaaaaatacgcctggaaaaatgaaaacgtccaaaaatgaaaagaaagacggaactctcagtagacctaaaaagaagagcgtggtgaaagtagaagcaaaaacagaatccgatcaagagattgaagaacccgatgaagatatgcaagctgctccaccgaggaaaccagaggaaaaaactgaggaaatcacaccagtttcaattaaaaaacgatcgtttcagcaagacgccacaaagaatctaaacaagagacaaaagtttgatctcaagagaggaaagagcatgaataacgtgaaaccaagaaaactttataaaatgcagctggaagaggatgaggaagatgaagagccgatggttgatgagacgccacaaaacactga