Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y57G11C.24   

sjj_Y57G11C.24 RNAi JA:Y57G11C.24
Simmer:Y57G11C.24
PCR_productsjj_Y57G11C.24
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y57G11C.24a Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24b Source_evidenceePCR411WS150 Sequence/Annotation Release
Y57G11C.24c Source_evidenceePCR810WS150 Sequence/Annotation Release
Overlaps_Gene Y57G11C.24 Source_evidenceePCR810WS150 Sequence/Annotation Release
Chunk_score Abs_score726
Max_abs_score726Y57G11C.24
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1489435714895676
Overlaps_transcript Y57G11C.24d.1 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24d.6 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24d.11 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24e.2 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24d.9 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24e.1 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24d.7 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24a Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24d.3 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24c Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24b Source_evidenceePCR477WS150 Sequence/Annotation Release
Y57G11C.24d.5 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24d.4 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24d.10 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24d.8 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24d.2 Source_evidenceePCR810WS150 Sequence/Annotation Release
Y57G11C.24d.12 Source_evidenceePCR810WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y57G11C.241320aagattatggaaagggagagtcgtttgaggcatgaggagaagcagattgagtaagtagattttgggaaacagaaaaaaaagttttgaaaaaattccaaaaaattactgtttcaaaacaatctcaaattcaaaattccagagatgaaaagcgacgaatgcacgccgagaaggatctcatcacaaaagagacaacacaaccagttccaccaccagctgcagtcgttacacatcaaccaatcaccaagcgatatgatccaccaatttccatctctccaccaccacaacgtaacaactattcacacgtgaaggttactgtagattctgacacatcgccacgtcagcaggcattcattgatgacatcgtggcaaaaggtggcaagttggcagtggtcacctatgatagaggaggtcagaatacgaaggagctgactgttcacaagggggagtatttggaggtgagatattgcagcagccgacttctcgcgggttcaacgaaattccaaattttcaggttatcttcgacgagcgcaactggtgggagtgcaagaatatgcatcaaagagtcggatacgttccacacacaattttgtcaatggtgccatttgagcaacaacaatatgcggtaagtcaaagctggaaacaataacattgtaaaaaaaatatgaatgggtggtaataatgacttggtgaaacagtatgaaatttgaaaaaaaaacatcgaaattttttttctgttacacagtttcggtttaatttttaagatgtttttaaaatgttagtctatgctttgtacccaataattttttaatgaaaactgttttaaaacttattattaatgacggcagagcactgcttcttggaaaaagaaaacgtgaaattttcataaaaattatcgacttcctctatagttttttagcagcagtataatgttatgagctcccaacacaatgtaatccaaattaatgacggtgttggaaaaatggaagtttttattagtaaaacttgtaatttcattttgatcaccacttgtaatctgttttgctccacaactaaaaccgcagtgcccgacatctaccgggcttttgtaatgaatgacgaaacccggcaaatgtcgggcacaccatgtgagaacagtcgttcctttttaagctcaaatactttgtcctcctctccagaaaatgctccagaaattccattacttgaaaatttgaaattcaatcataacaaactttatctgtttcacatactcgttaaaatcaaagacaattatggctttttagtaacagccatatttgcgcgccaaaattatcatgaattgat