Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y57G7A.10   

sjj_Y57G7A.10 RNAi JA:Y57G7A.10
Simmer:Y57G7A.10:Repeat_a
Simmer:Y57G7A.10:Screen
PCR_productsjj_Y57G7A.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F56D12.1a Source_evidenceePCR40WS150 Sequence/Annotation Release
Y57G7A.10a Source_evidenceePCR603WS150 Sequence/Annotation Release
Y57G7A.10b Source_evidenceePCR603WS150 Sequence/Annotation Release
Overlaps_Gene F56D12.1 Source_evidenceePCR167WS150 Sequence/Annotation Release
Chunk_score Abs_score146
Specificity_index0.221
Rel_score0.283
Map_statusBottom50_percentile_ePCRII13047601306430
Y57G7A.10 Source_evidenceePCR620WS150 Sequence/Annotation Release
Chunk_score Abs_score515
Max_abs_score515Y57G7A.10
Specificity_index0.779
Rel_score1
Map_statusBest_ePCRII13047601306430
Overlaps_transcript F56D12.1c.1 Source_evidenceePCR167WS150 Sequence/Annotation Release
Y57G7A.10a Source_evidenceePCR620WS150 Sequence/Annotation Release
F56D12.1a Source_evidenceePCR165WS150 Sequence/Annotation Release
Y57G7A.10b Source_evidenceePCR620WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y57G7A.101671tccattgaaaatgtatttgggtctgctaaatatgaattgtagtttgtagcccccagcaggcccaaatttctccaattttccacacacatacttgagtatatctcaaatcggctaatcgtctgaaatacatggaattcagcggcgaaatgagcacacactcctccaggcaatgtaccgcctttgccacgtcattttcgagcaggaaaagctcgctgagctgaagccaagcttctgggtcgttcaggaaaatctgaaaattaataaattttagagttttttttttctagaaatcaaatgaaaaccttcaggtaatcgttgatagctcgaattgcgtcgagacgctttccctgagcgagaagaaccgcgacttttcgcttgcggaagctctgaaaattcaaattattagaaattttgcaaaaaaaaaatttcctgaattttttacattattattgggctcatcctcaaccagtcgctcataaatatccaacgccttctgataatgttccgtagattccaactgcatcgctttcagcttcaaaactcgattactcttcggaaattgtgcgtgaagttggtcaatgcaatcctgagccagatcgacacgagccgcgtcgagtgctgcgatgcacacctgaaaaaaattggaaaaattaggtgaaaattcgattttctcgtgaaaaatgagtatgggtatgctaaatcgaagcttgtagtttgtagtctagcagaccaaatctcctcaaaactacattggtctgctaaatatgaatttgtagtttgtagcctagcagaccaaatttcatcgaaaccacttgggtctgctaaatatgaatttgtagtttgtagtctagcagacccaaattattgaattttttctcgaaaataatcattttttcagtaaaaaatgaccgtttttattgattttttccagtttttcgccgaaatttgtattattttcactattaatcaaccagaaacgtgataacttagaaaaaagcgtgggtctgctaaatataatactgtagtttgtagtctagcagaccaatatgcttttcaccaaaaaaaccagaaaatctatggtttttttctattcaaagccagattttcaggattttcagcgtttttcgacaaaatttcagcacctgctccaacacagcccattgctcgtctccaagagaagccggtgagcgtgaaataacgtgctcccaaatttcgacgacctcatcacttcgtcgaactccgcattctcgccactttttcagcgcttgacgtccttctgcaagcatttatcgatttttttttcaaaatttgaatattgtagaatgttaccatcgtaagagacttgcgtccactcggtttcaaccattttcgggagggaaatttctgaaaaatattgattttttccaactttttaatggaaaagttcggttggaaggtataaaaatagcgagaaaactataaaataaacggttatagctggaaaaaaggaaaaaaaacaaaatttattatgcgatcacgggggaaaaaaaattaaaattcagtggtaaagcaataattgttgacctaatcaaaaagaaaactatattctcaatatgagaaaaatcggaaatgaaaagaaaaaaacaacataattattccattgatggatatttccagtcagtcaatgacacc