Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y57G7A.4   

sjj_Y57G7A.4RNAiJA:Y57G7A.4
PCR_productsjj_Y57G7A.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY57G7A.4 Source_evidenceePCR515WS150 Sequence/Annotation Release
Overlaps_Gene Y57G7A.4 Source_evidenceePCR515WS150 Sequence/Annotation Release
Chunk_score Abs_score410
Max_abs_score410Y57G7A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII12693861270568
Overlaps_transcriptY57G7A.4 Source_evidenceePCR515WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y57G7A.41183gaacccgtgagatgtctggtgccgtgttctgacgctaattaaacccggcaaaggtcggctgatgtgtttgaagttagagtatgcagcagccgacaactgctgggtttcgctgtctcaaaaaatgacgggaggtttttttttgaaaagtttattctaaagattattgaatagcaattcgtcttgcaggtacattttcttgggaggttgtggatgtcacctgaaaaaaaatttagacaaaaattcctgattaatgaactagattttacgtgaaaatgcacttattttaagcccattctctattttttgagaggtaaaaaatttgcatttttgaaattttccaataaatgtccaacttacacttatcctagaggtcttcaaatttttataaattctctcacaaaacagcaattcttttgcagatttccgatactgtgaatgtacgcctaggcaaatcaaaaagtgaacactagcgttgattgccacgaaaattgtaaaagcatccatcaaatcgtagttgatatctctgaaatttcagattcccagcattttcagcaatttttccagcacataccgaaaaacagagcgtttcggtaaagtcccttcaagtatatagcagatcccaattggaccttctgatatcgtaaaggttactgtcattagaatcaccattttcgtagtttggtcggattttgtgctgtaaaattgtgctttaaaagaaaagtaactaaaaattcggaatccttatgaaaaactgtgttagaaaactttttattcaagcttctagctaaaattttagttttgaaggggtactgtagcttgagaagtacgcaaacaccaaaggtcttacgacaaaatgcacagatttctaaaagtgtctggaaaaagccacttaggggtaaaaatatacgctgaattcaaattttggaatcaaaatttcattcggcgtctagttttttagcaaacctttccagcctgctccccattgaagttgaagttttccgccggagcgcaattgcagctctcagctgctgaattagtaaaaatgtgaaaatcggataaattactgctggaattatctggaaatgtttggtcaaaagttttaaaaattttttgggggctcagtctaccttgctaaggccatcaagtatagtaaaaacagtgagaagtggcgtttgatcagctt