Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y59E9_120.c   

sjj_Y59E9_120.cRNAiJA:Y59E9_120.c
PCR_productsjj_Y59E9_120.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y59E9AR.7 Source_evidenceePCR393WS150 Sequence/Annotation Release
Y59E9AR.1 Source_evidenceePCR393WS150 Sequence/Annotation Release
Overlaps_Gene (33)
Overlaps_transcript Y59E9AR.7 Source_evidenceePCR393WS150 Sequence/Annotation Release
Y59E9AR.1 Source_evidenceePCR393WS150 Sequence/Annotation Release
WB_DNA_text sjj_Y59E9_120.c_1936ttcgaataaaaactggactggaatcaaatcaaatttattttccaactagcgctctggtatacaaatcaggttaacaaagtattatttgaaaatctttctgacgcgccctgttttgacagttcatttaaaaaattaatgtaacatttttatatattcgcgtgatctcctatttttggatgaactttcagatctaggacagagataagaaggctactataaattgagaaggttttgtcataatcttcactgcgagttctcataactccttcaacaagtcgccatggcccattctgcccaatctgtcccaccaggagacatccaaacccagccgggtaccaagattgtgttcaatgccccatacgacgacaaacacacctaccacatcaaggtgatcaactcatcggctcgccgtattggatacggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagcagttcttcttgccgtttcctgtgatgctttcgcctttggacaagaagacaccaacaacgatcgtatcactgttgagtggaccaacaccccagatggagctgccaagcaattccgccgtgaatggttccaaggagacggtatggttcgtcgcaagaacctcccaatcgagtacaacccatagagctctgtgccgttttttcaataaatgaattttgaaagatcgttgttttttctcttgtttaaaattttcagatttaaaaacgtatcaaaaaaaaaacgaatggttcgtcgcaagaatctcccgatcgaatataacccataggtgtcttgtgcaataaatatttttatgcgtgttttttttttcattgaaacaaatagcctctcttgagcttttcctccaatgtttcttcgaacacttcttcgataattctgaccttcgtcatc
sjj_Y59E9_120.c_2935gatgacgaaggtcagaattatcgaagaagtgttcgaagaaacattggaggaaaagctcaagagaggctatttgtttcaatgaaaaaaaaacacgcataaaaatatttattgcacaagacacctatgggttatattcgatcgggagattcttgcgacgaaccattcgttttttttttgatacgtttttaaatctgaaaattttaaacaagagaaaaaacaacgatctttcaaaattcatttattgaaaaaacggcacagagctctatgggttgtactcgattgggaggttcttgcgacgaaccataccgtctccttggaaccattcacggcggaattgcttggcagctccatctggggtgttggtccactcaacagtgatacgatcgttgttggtgtcttcttgtccaaaggcgaaagcatcacaggaaacggcaagaagaactgcttcctttgggtcgagaactccacatggtggatcaactccaagtctcttcatattggtggtcttgataccgtatccaatacggcgagccgatgagttgatcaccttgatgtggtaggtgtgtttgtcgtcgtatggggcattgaacacaatcttggtacccggctgggtttggatgtctcctggtgggacagattgggcagaatgggccatggcgacttgttgaaggagttatgagaactcgcagtgaagattatgacaaaaccttctcaatttatagtagccttcttatctctgtcctagatctgaaagttcatccaaaaataggagatcacgcgaatatataaaaatgttacattaattttttaaatgaactgtcaaaacagggcgcgtcagaaagattttcaaataatactttgttaacctgatttgtataccagagcgctagttggaaaataaatttgatttgattccagtccagtttttattcgaa