Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y62E10A.o   

sjj_Y62E10A.oRNAiSimmer:Y62E10A.o
PCR_productsjj_Y62E10A.o
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene H02I12.8 Chunk_score Abs_score129
Specificity_index0.131
Rel_score0.167
Y17G9B.3 Chunk_score Abs_score82
Specificity_index0.084
Rel_score0.106
Y62E10A.15 Chunk_score Abs_score771
Max_abs_score771Y62E10A.15
Specificity_index0.785
Rel_score1
Overlaps_pseudogene Y62E10A.15 Source_evidenceePCR689WS150 Sequence/Annotation Release
Map_statusUnique_ePCRIV1340101513402343
WB_DNA_textsjj_Y62E10A.o1329ttaaaacgcttttgatgctttgtgctcgtcttaaaaaaagctgaaacgaataattctcaaaaaaattcgtcttttctgggttaccgtactctttaaaggcgcataacaattttcacataggtctcgacaaagcgtgggagaaatttgaattttcaatcaaaaaacgtttgttttgttgcgattttcaggcttttcctcgagttttcaacgctttttgctcgtttttttcgctcaaataaattatttcagaagattctacaatgggggttatcatccccgctgtacttctcgcttcggcgacggtgattgcttggcttatctacaaacacttgagaatgcgtcaagttttgaaggtttgattgcaaaattcatttaaagataaattgaataaactttcagcacctcaaccaaccacgatcatacccaatcgtcggtcacggactcatcacaaagcccgatccagagggattcatgaatcaagtgattggaatgggatatttgtatccagatccacggatgtgtcttctctggattggtccattcccatgtcttatgctctactctgccgatcttgttgaacctattttctcttccacgaaacatctgaacaaagggttcgcatacgttttgcttgagccatggcttggaatcagtattttgacgagccaaaaggaacaatggcgtccaaagcgaaaactattgacaccaaccttccattatgatattctcaaggatttcttgccgatttttaacgagcaatcgaagattttgattcagaaattgtgttgcctcggtgtagcagagtgagaattttaattcttacataactctttcgaacgttttatttcagtgaagaagttgatgttctctccgtcatcaccctttgcactcttgacatcatctgcgaaacttccatgggaaaagctatcggtgctcaactcgcggaggttcgggaaattcttccatctatttaaatttctaaatgttttttttttcagaataacgagtatgtatgggcggtgcacacaattaataagctgatttcaaagcgaacaaataatccgttgatgtggaattcatttatttacaatttgtacggtatttagttttaaaattttaaatttatcattaaagatgatgtagtcgaatttttttttgctttattagactcaaaattgtctgaaaacttctcaaaaaaaattatgacggctcaaaaaatgacctaaaattaattaaaatttgaaatttgaccgaattgtcaagcggctggaaactaattttttcgggtatataagttaattatctcggggtttcaccttcatttaggta