Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y65B4A_175.a   

sjj_Y65B4A_175.aRNAiJA:Y65B4A_175.a
PCR_productsjj_Y65B4A_175.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56A6.4 Source_evidenceePCR316WS150 Sequence/Annotation Release
Overlaps_Gene F56A6.4 Source_evidenceePCR316WS150 Sequence/Annotation Release
Chunk_score Abs_score274
Max_abs_score274F56A6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI626737629436
Overlaps_transcriptF56A6.4 Source_evidenceePCR316WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y65B4A_175.a2700ttggataaaatttcgctgaaaaacgtatttttttgacagttttaaagggaaaattgtctaaaatcaaaaaaaaattgttttttcaacaattttttcagttttcgtaaaaatttcagtttttttttcgcgagaaaaaaaccaattctcgattgaaaaatcagaaaaaatattttggtataaaaatatttttggtattacgatattttgggtcccacctcgaaaatttagaggatttttcaaatttttaagattttcttcaacttttaacaatttttttcggaataaaaatcgattttcgctgcgagacccaaaaaaaatagattttctcgaattttgcgatggaacttttgatttttcggtgaaattttccaaaaaaatcgcaaaatgtatcaaaaaatcaatactttctgcgtctccttctcatcgtcggttagtttccgtttttcgggtctcgccacgacatttatgtcagtattctcttgtgagcttgagcacaacgagtatgagctcgtctgattctgacggatcatttcgtcaagattgagcattccctcatccagccatgtttttgccgcagctggaattgcatccttattcactgcgtcgacgatggaaaagctcgcggagtacctggaaattatcgattttttattgattttttatcggtttttatcgatttttttgatggggaaaaatcggaaaaatcgataaatttcgattggaaaattcaaaaaacttcgggtctcacaacgaaaattgattttttttcttggattttcaaatttttaaacttttgttgtaacaacagtggaaatttttcgaaaaaaaatcaataattatcgattttttgaaaaaaggcaataattttcgattttttgaaaaaaaaaatcaataattatcgattttttgtgaatttttgaaaaaaatcaataattttcgattttttgtgattttttttcgaaaaaatcaaaaattatcgattttttgtggattttttgaaaaaaatcaataattatcgattttttgtggattttttgtaaaaaatcaatagttttcgattttttttggaaaaaatcaataattatcgattttttgtggattttttgaaaaaaatcaataattatcgatttttttttgaattttttgaaaaaaatcaataattttcgattttttgtgattttttttcggaaaaatcaaaaattatcgattttttgtgaatttttttttggaaaaatcaataattatcgatttttgtgattttttgtaaaatatcaataattatcgattttttgtgatttttttcggaaaaatcaaaaattatcaattttttgtgattttttttttggaaaaatcaataattatcgatttttgtgattttttttggaaaaaatcaataattatcgatttttgtgaattttttgtaaaatatcaataattatcgatttttttgtaattttttcggaaaaaatcaataattttcgattttttgtgaattgattttttttggattttcaaaattttaaacttttaaaataaatttttccatagttttttgttgaaaaattcctgaaattttgaaattcaattaattttttctttaaaaaaatcgttgaaaaattagttttttggaaaaaaaatcagcgaaaatagatttcgctgtgagacccaattgggctcctcaaagtccctgcgcctttaaaatatcgttttttttttgttaaattttcccgcgaaattaatcagattttttctgcgaaaaagtgaaatttctcaaagaaacttttgaaaaatcaatttttttaaaaagaaaacccctaatttttccgtttttcccgctaaaaaaacatctaaaaaatttgaaaaatccacagaattatcgctgtgggacccaaagtgcatgcgcctttaagattatcgatttttttcaaatttttcaatcgaaatcaggttttttttttcagcaaaaatcataattttgcgaaattaatctgattttttgtgcaaaaaattcaaatttctctttttttacgttttttcgccaaaaaaaccatctaaaaaattcgaaaaatccagagcattttcgctgtgagacccaagtccgtgtggctttaaaaatatcgattttttgttaaattttccaatcgaaatttggctttttttccggtaaaaaatcataattttgcgaaattagtctgattttttgtgcgaaaaagcgaaatttctcataaaacttttgaaaaattgattttttttttctggaaaaacctatttttgtcgttttttcgctaaaaaacatctaaaaaattcgaaaaatccccaaaattttcgctgtgagacccaaggctcctgaaagtccctgcgcctttaaaaatatcgattttttgttaaatttttaatcgaaattcggctttttccggtaaaaacatcaaaatttcgcaaaattaatctgattttttctgcgaaaaattcaaatttctcataaaactttcgaaaaatcgattattttccgctaaaaaatcatctaaaaactcgaaaaatccagacaactttcgctgcgagacccaagtccatgcgcctttaaaaatatcgattttctgtgaaatttctcacaatttctccaaatttcccgccgtcacattcgtcgtttcctcaatcataatacagtcctcatcatcatcatcatccgagaggactacaatc