Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y65B4A_182.a   

sjj_Y65B4A_182.aRNAiJA:Y65B4A_182.a
PCR_productsjj_Y65B4A_182.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y65B4A.2 Source_evidenceePCR115WS150 Sequence/Annotation Release
Y65B4A.7 Source_evidenceePCR300WS150 Sequence/Annotation Release
Overlaps_Gene Y65B4A.2 Source_evidenceePCR117WS150 Sequence/Annotation Release
Chunk_score Abs_score96
Specificity_index0.305
Rel_score0.438
Map_statusBottom50_percentile_ePCRI644813646002
Y65B4A.7 Source_evidenceePCR300WS150 Sequence/Annotation Release
Chunk_score Abs_score219
Max_abs_score219Y65B4A.7
Specificity_index0.695
Rel_score1
Map_statusBest_ePCRI644813646002
Overlaps_transcript Y65B4A.2 Source_evidenceePCR117WS150 Sequence/Annotation Release
Y65B4A.7 Source_evidenceePCR300WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y65B4A_182.a1190aatggggtgtcctcttgttaaatatcgaaatttcactcaaaaattttgaacgttgagctttttgtctctggtcaattggtcagccgcgcagtgttccggtgtttgtgctcatgttttcgtgtgcacatttgtgctgctgctaaggcgtattttgttccgggcggggacaggggggagaagcaaaaatgtgtcaaattttgtttgttttgccattgatattgtccttctgctcagaggatttcctcattttacgccgtatgtgcaaaagcataatcaccacaataattttgaatataagtttgcaaacgcgccctattgataatcctcgcccgtgtagtctgcgtgcacgtggtgtcaaagtgtcccattttggtttgatctccgagaaatgcgggagaagaggtgcagacttttcaactgattttgcatggttaagagtgtgctggcgtcacgtttttctgggggcaaaaattcccgcattttttgtagatcaaattgcaaagcgccctattgataatcttagcccgtgtagtctcttgtttaattttcaatttttctggttcggcacctaaactgtaactacgacactcggcaaagttagactgttaaactccgcccacttaatggcaccttttttgcagaaatgtacccaaccgacaaagagcagacacggaccacatttgagacgagaagtcggcggaaacggctggcgcaggtcgccgccacaattgctagcgtgatattactcttgttggcaggtaagtaaaaaactacgacactccgagaccaagaaaaaaatcgataatcgaaatattgaaaattgcaaaatttatttcgccggatcattttccatatcgattttctgaatggtatggtgatagcaatcctcatcgtaggcacatccctggtgaaccacgtactcttgacctgaaaaataggtttcgttcggtggagcacatttgcatacactgacctttaatcgggtggcgacacgctttacacttgaaacatgccatatgccagtggacattgaacgccgacacgcatctctcaaaagtcggcaatttgcacgcgtggcattttggtgacttggccgcccggtgacagtccgcgcaacggagcgcgttaccgtacggcgcgggcattggataacacggagtcatgccaatgactgtctggaattttggaga