Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y65B4A_185.c   

sjj_Y65B4A_185.c RNAi JA:Y65B4A_185.c
Simmer:Y65B4A_185.c:Repeat_b
Simmer:Y65B4A_185.c:Screen_A
Simmer:Y65B4A_185.c:Screen_B
PCR_productsjj_Y65B4A_185.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY65B4A.9 Source_evidenceePCR347WS150 Sequence/Annotation Release
Overlaps_Gene Y65B4A.9 Source_evidenceePCR347WS150 Sequence/Annotation Release
Chunk_score Abs_score264
Max_abs_score264Y65B4A.9
Specificity_index0.729
Rel_score1
Map_statusUnique_ePCRI665379666366
M04D5.1 Chunk_score Abs_score98
Specificity_index0.271
Rel_score0.371
Overlaps_transcriptY65B4A.9 Source_evidenceePCR347WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y65B4A_185.c988tgagattttgaattttgctccattgataatggtgtttttttttgaaattctgcaaacattaatttctagaaaatttgagtttcctccaaaatttttcacagaaaatttgaattcccgccaaaattttttctctgaaaatttgaattcccgccaaaattttttctctgaaaatttgaattcccgccaaaatttttttcagaaaattttgaaccccgcttaaatttttctgaactaggctattttgtctcggccatatctggggttgtggtttacggcgcgttgcgtgtcgcgtcgcggttcgattttagttgtaaaactaaatgtatttgtccgtgtggagtacgcgactttcccacgcgttgttcgtcaggcaattgtcaatggagcgcaaaaactgccgaccgctccaaataactactttttgcacttcattgcatacacacagcagctcgcggcgtcggcatgaggcccgcatttcgcgcctcactggaagccccagatgccaaaaaatctacctcggtctcttgcacaacccgaaatccaacaggtaaacctgatggtgctgtccgtcaatctctcttccaatacagaaatgcgatggcttgatgtcgcgatgaatgaatccattccggtggaggtcacgaatcgcggccagcgtctgctcggccaagtgaagacccgtcgccatgctgaacttgcgatccttgttcgtgttcatcatcagctcgtataggttctcgccatactgaaatatggaatttggctgaagttaggcaacgaaaaatggtaccaatggcatcacaatgaagaggaagcgatttggaaccgtgccacgttcctcgatattcgtgaagaatggagatgggtggtggatcgacgcgaggacaactgacatttgacgaagaagctggaattttttttgctctctagaaacggttttcacggcggccgacaatttccgagtttggaaactcactgcacttagtca