Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y65B4B_10.B_b   

sjj_Y65B4B_10.B_bSequenceAAAGTTCTCGATCAATAGAGGGG
In_sequenceY65B4BR
PCR_product sjj_Y65B4B_10.b
smd_Y65B4B_10.d