Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y65B4B_10.a   

sjj_Y65B4B_10.a RNAi (14)
PCR_productsjj_Y65B4B_10.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y65B4BR.4a Source_evidenceePCR550WS150 Sequence/Annotation Release
Y65B4BR.4b Source_evidenceePCR550WS150 Sequence/Annotation Release
Overlaps_Gene Y65B4BR.4 Source_evidenceePCR550WS150 Sequence/Annotation Release
Chunk_score Abs_score487
Max_abs_score487Y65B4BR.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI537185538151
Overlaps_transcript Y65B4BR.4b Source_evidenceePCR550WS150 Sequence/Annotation Release
Y65B4BR.4a Source_evidenceePCR550WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y65B4B_10.a967gagtaatggaactccagcacaacaaaacgggtcggcaaaaccatcaaaagtcacagtaaaaggtaacaattcgtagattttttgcatctgttctaataatatttccccctcttaatcatagtcgtcaacgcgtcgttcaccaaggcagccgactgctatgtcgaaatcacgagtgacacgtcatcggcggcgccaaaaaagacgactgtaaagaagaagacgatggcgcccgagtggaatgaacatctcaacgttcatgcaaatgaatcttcgacaatttcgtttcgtctattgcaaaaagccaagctattcgatgacacgtgtctagggatggcgaagctgaagctttcgagtctcacaagaaatgagaatggagagtgtaagtggttttattgaaattttctcaaaaaatctattatttcagtcaaaaacgacatcaacaatatatctttgctggccaaagactcctcgaaaatcggaactctcaacataattttctccggatatccagagcggaaacgaagaagcgcaggagtacgagctgaaaccgccgcgtctgcaagttcagaggcatccacgtcaaatggcgttgccacgtcatcctcggcgcggagaccggcgacagcgaagcgtgacactttggcggctccaacggtaatcgtgacgagacccattttgaattatttaattattcatgaaacgctctactggagtgttcataattattagagcgcgctcgcgcggcacctcacgaactccagaattcgcgaggacagcagtttttggctattttggcttctatggaaattatttttaattttttgatttaaaatattgttgagaagcatcatccaaattgaaaatgtgtaaaattatgaaatttgaccgaaaactgaaggttttacagagaggagtcaccacggctttctttaaaaagtatcagtaccgtcagtatttcgatttcaga