Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y65B4B_15.c   

sjj_Y65B4B_15.cRNAiJA:Y65B4B_15.c
PCR_productsjj_Y65B4B_15.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY65B4BL.1 Source_evidenceePCR154WS150 Sequence/Annotation Release
Overlaps_Gene Y65B4BL.1 Source_evidenceePCR154WS150 Sequence/Annotation Release
Chunk_score Abs_score133
Max_abs_score133Y65B4BL.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI530422530796
Overlaps_transcriptY65B4BL.1 Source_evidenceePCR154WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y65B4B_15.c375gacccgatccaacttcttattcttgttccttagccttctccccctcccatgtcctcccgatatccaaaaagtgggaggagcatgccatagtgagagggcggggccgggacacacacaaggctggccccgagaaaacgaacaacacttatgccgaggacagtctcgacagttggtggtcaccccacctgcgccttgattaccccgcccgtccgcgcccgccgggctaaagtattttgtttgccattcatgttcctcattcgacgttcatcatgcttctgttatgcttcttggtgttggtccggttcctttctctctctctctctttcttccttgtggatcagatgccattccgcctttttgctagataagcgcata