Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y65B4B_9.b   

sjj_Y65B4B_9.bRNAiJA:Y65B4B_9.b
PCR_productsjj_Y65B4B_9.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY65B4BL.5 Source_evidenceePCR276WS150 Sequence/Annotation Release
Overlaps_Gene Y65B4BL.5 Source_evidenceePCR542WS150 Sequence/Annotation Release
Chunk_score Abs_score502
Max_abs_score502Y65B4BL.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI511215512142
Overlaps_transcriptY65B4BL.5 Source_evidenceePCR542WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y65B4B_9.b928aaggtgagggaaaatggaaataataaagtgaaatgttttgtgtacttgcgataaaacaatcaataaatgggaacaagccgatgataaactgataaaccgaacgtgaatatcgagagagggaggaagaaagcgtatacccgttaatgaaatcaagttaatggaattatttggattgaaacaaaacaacgaaaatatcaatgtttgagcataaggaatgagggaatggcactggtggtggtggataaatgaatcggggggaacggaatctatggaagtttcgaatacatcgcatcgagttgcttcgagtagtgagccttcagcttcggacgcttgctcttcaacgttggcgtgagaagatcattctcgacgctgaattgctcggcggagagactgatatcgcgcacttgctcgaacgagaagagcccggctttcttgccaacagcgaccatgtcatcgaggatcgcctttttgacggcgtcgttgttgcacagctcttcgaatgttcccttgattccttggtcggccatcgctgggacgagaacctagaaaaattgaaaattacatatatatatatatatatacacgctctcctcaaagccgaataattattagagcgcgcttactgcgcttcgcgtttctgcatccgcggcattttgactttacactgaaaaaagcagatatttcagatttatcgaatttttagcttttaaaatttttttctgcatttttcgaacaaaccttttgttaaacagtgaaaattgaatttaaaatgactaaaatgaacttttttcgttcactggttgtgaaatggtttgaatttgaagaaatcaaagggatttttctgaattttttaataattttctattaaaaatcggttttaaaccattttttgaccctaatgttaagtcacaaatgtattgaaaccggt