Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y67A6A.1   

sjj_Y67A6A.1 RNAi JA:Y67A6A.1
[cgc5655]:Y67A6A.1
PCR_productsjj_Y67A6A.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY67A6A.1 Source_evidenceePCR372WS150 Sequence/Annotation Release
Overlaps_Gene Y67A6A.1 Source_evidenceePCR372WS150 Sequence/Annotation Release
Chunk_score Abs_score330
Max_abs_score330Y67A6A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI98294769830435
Overlaps_transcriptY67A6A.1 Source_evidenceePCR372WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y67A6A.1960tgctgataacccctgattctaaaatcctgaaagatctcactacatataaatgaaaatatgactacaattttcacgaaaacactccaaaatataagattgacaatagctaaaacttcgaaaaactggtgggcgtttgccgaagattttagcattcagcaatatcggcatttgctagctgcatattagttcggtttcagtgcagcactggcgtgagtcgtatccccatgtgaactcataattagtttcttgtaaccacataaatacaccgaacttaaaaattcttttattaaaatacaatactaaaagattcctttttgcttcagtttctcgaccatttgctcattgagcagcaccggcgcctggaccgaaatcctcgtagccatcgtccatttttgtcttcttgccgtcctccttcacaagaacatccattccacttggttcgttttgctgaaattatttcaattatcaactattttcaagacttaatcaattttaaaattcaaattgttaccttattaggatcttcctccttctttgcctgatccttcgaagcatctttttttggtgtggcaacaaccttcttctcggcttcctcttttgccttcttctctttcaactcctttgcttcctttgcctcctttgatttgtccttttcattcatatccaccgaagtttgcgatttggaaatcgacaaatttgacttcttcttcgttttcgaagttttcttcttgtcaacgccgtctttcttcgtatttttactctttccattcgccatttctttgttttatttcgatgaatcgaaagtctgaaaattatcgattaagttgatttgcatacaagaaaatataagattatttgccaaaaattgtggtcctaagttgtgactcgagcagagcttttatgctacgaacgcagtgaaaaactcgcggggactgtatcagtttctctcgtgctagaacc