Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y6B3A.1   

sjj_Y6B3A.1 RNAi JA:Y6B3A.1
Simmer:Y6B3A.1:Screen_A
Simmer:Y6B3A.1:Screen_B
PCR_productsjj_Y6B3A.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y6B3A.1a Source_evidenceePCR708WS150 Sequence/Annotation Release
Y6B3A.1b Source_evidenceePCR708WS150 Sequence/Annotation Release
Overlaps_Gene Y6B3A.1 Source_evidenceePCR708WS150 Sequence/Annotation Release
Chunk_score Abs_score666
Max_abs_score666Y6B3A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1362202613623678
Overlaps_transcript Y6B3A.1a Source_evidenceePCR708WS150 Sequence/Annotation Release
Y6B3A.1b Source_evidenceePCR708WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y6B3A.11653tctgttagcctcaaccaactttctaggcatttaacgtaacaaatttaaattaaataacgtaccaattgtattaagaacaatccatttctgttcaaaagcacacgtattcgaatcaagcatcggaagaatgacactattaaagaaaacctcaatcgaagctttgagatgtgttttaaatttgtccaatagctccacaaatatggccagcgacttttcaaatacttgaatattattgctaaccgcgttacgggttaatgccatacacaacgttcgtttaataactattatacacggctgggaggattgaaggattgatgaagagttttggagtacaagaagaagcatttccagtgcaagaagtttcgatcgaaggctcatttcatttgatgcaccaccttcttccttctgtgcaagaatacaaagagcacggaatactagaaaagcatccttttgatatgcattcataaatgtaaattgatcatccagtggagcctcactttcacccattgttgagccattctgtcgatgagttcctccggcttcacttgtttcgtcgctctgcaaacattatttaattaaatatttaaactattggctacaaactacacattttcctatgccactatcgtgtagtttgtagttttaactttttttttagaactaaactattttaattcgaaaaatttaataaaaagctcaaaaactagcagttttcactaaaaatcatgtaaaattttgggtgaggcttagaaacttgtagtttgtagtgtgagtctcaaccaaaatatttttttcgttgaggctaataaaatattgtagtttgtagtgtgagcctcaaccaaaatattttttttcgttgaggctaataaaatattgtagtttgtagtgtgagcctcaccaaaatatatttttttggttgaggctataaaatattgtagtttgtagtgtaagcctcaccaaaatacatttttttggttgaggctataaaatattgtagtttgtagtgtgagcctcaccaaaataattttttttggttgaggctaataaaatattgtagtttgtagtgtaagcctcaccaaaatatatttttttggttgaggctataaaatattgtagtttgttagtggattttcagcgaaaattgtcgttttttcgaaaaaaaaaatcaaaattcctttcagactacaaactacattaaccattaaaccattaagcttttaaaaaaatcctaaaaatcagtttttagccaattttcaatgttttttcaatgaaaatttaaacttttcgttcaaaattcgatgttttcgtgtgaaaaaaatacatttttagaggaaaatgtagatgttttcaagaattacgatatttctttctagaaaaaaaccctaccacttcattggatattgtattcgatacaagaacctccacaacttctctcacaatcgtctcatcgtctttaatatttccaaacttttccatatttccaaaaaccgtattgataacctgaaaattttgaaattattaaattataaatctgatttttagtgatttttctcacctgtgtaagtgttcccttagccgtcgcctgattaatcgggctttttgacgttaaataaatgttgaagcatgtccgaacagcgagaataagtgatgctc