Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y6B3B.1   

sjj_Y6B3B.1RNAiJA:Y6B3B.1
PCR_productsjj_Y6B3B.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY6B3B.1 Source_evidenceePCR981WS150 Sequence/Annotation Release
Overlaps_Gene Y6B3B.1 Source_evidenceePCR981WS150 Sequence/Annotation Release
Chunk_score Abs_score960
Max_abs_score960Y6B3B.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1369750513698485
Overlaps_transcriptY6B3B.1 Source_evidenceePCR981WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y6B3B.1981ggaagatcagagctcatttcagaagacacagacggctgagctatctccatgtgattctctgatccctggtagctagccttctcctgaatcagctcaaccaaatctatactgtgctcctccgatcctttaactatcattagatcctgctggttaggatctgtgcccttgttgcctggatcttcagaactttccagcttctgatcctttggaactgtcactttgggaaattgatcctgaggcttctcggcttccaatttcttgaaggtggtttcagtgttgggatccttggcgtcatggtcgttagctgaagcttcagagtcaggactagtagcaagcaggatccttgtctgatctgttccagctacatcttgaagctctggtttcatcggttcaaaatctttgtttgtctcagatccttgaacagatcccgtagaatcatcttgtccagggatatttcctagattctggaaaccctgatcttcaacgatttctccgattctcttcggacctgcttccgacgacgctgacgcttcagatgactcaccggaagcattaaagatcagaggatcctgattttttatagctgcttcaatgatcggctcggatatcgggggatccatggaaacctcaaaacaggtagggatcctggatgttggatcagactgatcttcagatccttgagtagaatcttgatcctctgaggttcttgtagccggcggagacgtagaacacacgcctgatccttgacccaggagaacatcggaactagtgaaattggacaattcttgatcttcagccgagccggattttgccggatccctgatctttggtatgccgtcgaatcggatcttcaagcagaccattgtagctgatccctgatccttctgcgcaccagcatccacttcaggatccctctttcttttcctcctcctcactggtcccaattcagctgggtattccgatctttccgatatctttctt