Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y6D1A.d_b   

sjj_Y6D1A.d_bSequenceAGTCCAGATAGAAGACAAAGCCC
In_sequenceSUPERLINK_CB_II
PCR_product sjj_Y6D1A.d
smd_Y6D1A.d