Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y6G8.2   

sjj_Y6G8.2RNAiJA:Y6G8.2
PCR_productsjj_Y6G8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY6G8.2 Source_evidenceePCR971WS150 Sequence/Annotation Release
Overlaps_Gene Y6G8.2 Source_evidenceePCR971WS150 Sequence/Annotation Release
Chunk_score Abs_score889
Max_abs_score889Y6G8.2
Specificity_index0.883
Rel_score1
Map_statusUnique_ePCRV1759710817598254
Y20C6A.1 Chunk_score Abs_score118
Specificity_index0.117
Rel_score0.133
Overlaps_transcriptY6G8.2 Source_evidenceePCR971WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y6G8.21147atgcaaactgctctccgtctgtccatttccattttgaagaaccactttttatgaacaacattttgttcgatcttgtttgaaagagacggtgctcctagagttggggtcaaatcttctgcatcgaatgatctggctttaatgtcaaattttcgattggcggatgaggttttgaagatctgaaatttataccatagataaccacgaacaacttgtattatgcctacctcctttaaatgaaccaagtcttcaacggaaattgtgcgtaacgttacttcaactctcagaaagtgctcgatatttttaactgaaaatgaaagtccacagtcacgggcccaaagctcttctgcccttttccattgccccaactccacaattttagtagagtcaagctcctcttcttcaaccttactatatgcatcatagttcaagaaaatcatttttaggtcattttgatccaaatatgacagaatccttgctattatcggtagatcaactcccagcatggcaacacacttgacctttagtagacgagttctttgaggcaccagagtttcctttagcttataaatgtactcatcatctatggaacgcagggtaaaagcgagtttgcttatgggagttttttggtgcttcagaatttgttccaagtcattcatacaacagtttaacggtgtatcgtctggcatcatccgagttgcaatgaaatcagaaccgtaaggtatcggcggatatgcaagaagtttgcagccgatcggatcttttttataggtaagggatgttttcccctcgggggttattacttcaagcattgaatcttttccatcaaatgttatccaaacattccgttcggggaagttgaaatgtgtggtgtcgatgaaattacggaggtttttacaaacttttcgaagcgtcaagctgaaattcataaagtacgatgtgatcacgcaacagaaaatttacattgtgacaaaggagcacttttctatgatacttttcatagcctggtaattagtcgatatgagagatagcaagttgaagtcagagtttacgatttgtggttttacctggaaactggcaaattattatctagataattttcttccgttgtcttgacatactttgacagcggctaaaacttaccggaggc