Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y70C5C.1   

sjj_Y70C5C.1RNAiJA:Y70C5C.1
PCR_productsjj_Y70C5C.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY70C5C.1 Source_evidenceePCR988WS150 Sequence/Annotation Release
Overlaps_Gene Y70C5C.1 Source_evidenceePCR993WS150 Sequence/Annotation Release
Chunk_score Abs_score930
Max_abs_score930Y70C5C.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1670588116706959
Overlaps_transcriptY70C5C.1 Source_evidenceePCR993WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y70C5C.11079cgataaagaatggagcaaacaacaactgcttgcggtttgtgagagcgtgaaattggaagatgttcaacgatttggaaaagagatgcttcaagctttccatctggaactgttggtttacggaaattctaccgagaaggagacaattcagctgtcgaaagatctcattgatattctcaaatccgctgcgccgagttctcgtccattattccgcaacgagcacatcctacgtcgcgagatacagttgaacaacggtgatgagtacatctacagacatcttcaaacaactcatgacgtgggttgcgtgcaggtgacataccaaattggtgttcagaatacgtacgacaatgctgttattggacttatcaagaatctcatcaccgagccggctttcgatactctcagaactaaagagtcattgggtgagaaaaattgttggtttttctaacaggtacaaattttcaggttatattgtttggactagaacacactttaactgcggaactgttgctctccagatccttgttcaaggaccaaaaagcgttgatcacgttcttgagcgcattgaagcatttctggagtctgttcgtaaggagattgttgagatgccacaagaagagtttgaaaatcgagtttcgggtttgattgctcaacttgaagaaaaaccaaagacgctgagctgcagattcaaaaaattctgggatgagattgagtgccgacagtataatttcacacgaattgaagaagatgtagaacttctgaaaactatcaaaaaagaagatgttattgcactcttcgataagtgagcatttgcaatgatgcttttgggacgatgttttttacagaaaaatccgcaagggtgctgcagaacggaggaagcttgctgtcattgtccatggaaaaagcgaagaccgagcggctgtcaacgagatcatcaagaaacatttggaagacggtaaaaaaaagaaggaggttctctatttggatcagctgcgacaattcctgccactctacggccaaccgattgctgcaatcaatctcaaaccaattggtattgacccatgtttgggacaatgaataac