Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71F9A_284.b   

sjj_Y71F9A_284.bRNAiJA:Y71F9A_284.b
PCR_productsjj_Y71F9A_284.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71F9B.10b Source_evidenceePCR380WS150 Sequence/Annotation Release
Overlaps_Gene Y71F9B.10 Source_evidenceePCR392WS150 Sequence/Annotation Release
Chunk_score Abs_score309
Max_abs_score309Y71F9B.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI27755482776095
Y71F9B.13 Source_evidenceePCR7WS150 Sequence/Annotation Release
Overlaps_transcript Y71F9B.13c.2 Source_evidenceePCR7WS150 Sequence/Annotation Release
Y71F9B.10a.1 Source_evidenceePCR392WS150 Sequence/Annotation Release
Y71F9B.10b Source_evidenceePCR392WS150 Sequence/Annotation Release
Y71F9B.10a.2 Source_evidenceePCR392WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71F9A_284.b548ccgattttgcaggtactaatctgaaagatagctttattgttttggtaaaatcccgtattcaacgcacttgatcctctgcaacaccaatgtcgattgttacatcaggatttctgattgaaaatccactattttgagttgaaaacacgcaatgttctctgaaaaaaaaattatttataaaatttttaatttaaaaaaaatttaaaaaagcactcaccctaggccttcagataattgttgaacttttcgagcaatagtagcatcattatcaattggtaaatgctctttcataaaaaccagagagccaagaacgtcgagacgggttcgtgcatcgagtgtttgccttttctcctgaaaatttgatttttttttcaatgaaaaacggtggagattgcagttaccagcaaattcctcctgacagatctcgcaaaatgctcccatcccagcttttctgcgctttggcggacattttccattcgcaaatctcgatcgatcgactccaggtttaactcatgatttttcctctcttcaattatcatggtaggtttcgc