Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71F9A_291.a   

sjj_Y71F9A_291.aRNAiJA:Y71F9A_291.a
PCR_productsjj_Y71F9A_291.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71F9B.15 Source_evidenceePCR636WS150 Sequence/Annotation Release
Overlaps_Gene Y71F9B.15 Source_evidenceePCR636WS150 Sequence/Annotation Release
Chunk_score Abs_score531
Max_abs_score531Y71F9B.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI27830882784279
Overlaps_transcriptY71F9B.15 Source_evidenceePCR636WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71F9A_291.a1192tttacccaactcatcacaaatccctgtagttttacaaatctcgtcacggaacgaattgatgtaaacgatctctaggatgtcgtaagctgaaaaaaaaccatttgatttctctgcggtcacacagtaaaaatctacctttatcactattcaacacacgatttgtatatccaacaaatgtccagtcaccgtttgccgcaaaaaatacatttccagagactccatggctgaattccgcacagaacacttcactttttgggattttgcattcaacaacctgaaaatctgggagttggcggaggtaggcggacgtaggcaggcggaggcggcaataggcaggcgtaggtgagagtagacaaatttaagcaggcgtaggcgggagtaggcaggttgagcagacgttggtgagcgcaagcgggcgtacacaaatgttcactcacatatccagttctatataaattcttgactagaattctgaccgcatctcctgccacaagttgctttcctattataaaaattgagttataaattctgttcggaaagttgaaggttgaataccttgaatacataagtaatcgttcctgggcatactgaaagctccaatgacagctccaatcggttttgccttgcactgaccaatcagccgagctgggaatttgtcgatattaattaccgaagagatgtccttgtttctggaataatatggtaggcaggcgtaggcaggctagggcttccgcgcccgcctgcctctcgacgcgagcctcggctcctgtagagtgcggcgtggaaccaaaagtgtgcagaaatgaagcgagaggccggcgtgaggcgggcaggttggaggcaggcgtcaggccttgaaaccgtgcctgcctcccatggaagccctaagatgcctatctcactctgctttacaagatttcatgctatattttgatccaataatgctaagatccgtaataaagtggtaaggcgacaccataaaagttcgatatcctccgtctaaatcgtaatagtaggcggatctgaaattgaaaattaggaatttattggctgacaaactcacttttccgatctcccacagattttgagtcttttctcattttgctcttcggtcagcttcaacatctgcccattgcatgttaccaggaaaaccaagaaaacaagacatttcggcagtaacaccatagttttt