Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71F9A_294.e   

sjj_Y71F9A_294.eRNAiJA:Y71F9A_294.e
PCR_productsjj_Y71F9A_294.e
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71F9AL.8 Source_evidenceePCR999WS150 Sequence/Annotation Release
Overlaps_Gene Y71F9AL.14 Source_evidenceePCR37WS150 Sequence/Annotation Release
Y71F9AL.8 Source_evidenceePCR1007WS150 Sequence/Annotation Release
Chunk_score Abs_score839
Max_abs_score839Y71F9AL.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI28785612880956
Overlaps_transcript Y71F9AL.14.2 Source_evidenceePCR35WS150 Sequence/Annotation Release
Y71F9AL.8 Source_evidenceePCR1007WS150 Sequence/Annotation Release
Y71F9AL.14.1 Source_evidenceePCR37WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71F9A_294.e2396aggctcttaatttttcagatgggaaaccaacgacatcattataacgattacgaagatgtgagaatgctcaaatgggttgccaggcaatatagaatgcttaaatgatatttcaagaatcacctctttcagaaatgacaagagccttggaccgtttggaataatcacgtggcaactgtacgttgaagcctacaattgtccgtattcagtgcaatcactgtgtggacggtgcgaatttttagaaaaaatcgattaaaaatatggaattaattacagaatgcgacgtcaaattgtcccgaatatcgattattactctcgacatttgaaatcttcggatttaatttcacttgagagacgttttgggtcaagactcggtgctgagactcgaaaatagtaattattaatttcagaaaacatgaaataattaaaaaaaatgtttttagcattcgaaatttggcagtaaaaaccgtgaaaatcgtgcaagtagttgcaagccgcccggtggagaaaaattctgaaattgaggtgcaaaaggtcgcaagcttggagcttcaagcggctccgacggctccgacgaccagcgcagcacaattgggcaaaacaaaaagtcctggagcaagaactcaacggatcgaaagaaatgatgagttatcccgtgatgtgttcgaaagttcttgtgcttcgacaattgtggagccagagcctccacaagaagagcctccacagaggtgaatactccacagatgtcacaaaaaatcgaattttttgccaaaaaaactagtttttgctccgaaaaaccaacaaacatcgatttttttttaaattaaaaaaaaacttttttttctctcattttttctgcagcaggaaataaataaattgaggaaatattttcagatcacacaattggaagacggaaatgcgaaaaatagccggccaagcagctcaagcaattaacgatttgatccgacagactgttgaaaataatgatttcaataaggtacagcaaagataagatgcatgtacctttaaatgtgaagtacggtcgtatacggtgcccggtctcgacacgacaatttttttttcaatcaatttttacggttgtgcgcctttaaagaatactgtaatttcgaactattgtagctgtggaattttccaccaatttttcagtttttctcaaagtcgtgtgtttttttaatcgaaaagctatgaaaactcctcagaaaagagtagtttgaaaatacagtactctttaaaggcgcaaacccttttgtgttcgacaaaaattttcgtgtcgagaccggctaccgtatttttggtgcgaaatttcgcgtctggataataagagaaacactaattttctttgattttgtgaaaattagaaaagaaaaacatttttttccggtttttggctttaagcaaacacttaaaacggaacttctcgttttttttttggaaaaaaaaattaaaaatcggagaggaacttcaaaccaatcagcgcctggctccgcccaccttcgctgattggtttggaatttttggccctaaaaatgacacaatttcgtataaaatacagtttcttttttttcagaaaatgttcgctgaactcgagaaccaacaaaatctagaccacctgtacggaaaaatgttcgacgatccaaataaagccgattggataatgattgatgtcaaaaagttcactgaaaaccaccttcgcatgcaatatttccgtaaaatacgcgaagagctacacaaaagattcaccaatcagcatatcattcgtgccgttttttgctttttccaattttttgagtattatgtgacagtttgtgttgatgtgagtttattccgagaaattgaaaacttctcgatttacctgaattttttacttgaatcgccgcgcttttgtctctaaactccgcccataaaaccgtgccgcactgtttttttttctaattttcaattaagaatacggtcagcaatgttaaacaattattgaaaattagaaaaaaaaaacaggaatctgtgtcgaaattgaaaaaaccagagtgcggcacggtttttataggcggaacttagagacaaaagcgcgagaattcaaattaggcgtaaaaaatccgaattttttcgtttttttttcttttttggcatttgggactagtttttgagtattttaaattaaaatcctttcaaaaaattaaaattaaatttccaggagtccaccgacaactacattctgctaatgaacaaagttttggaaatgtccatcaaattgttgccactttatattgttcattgttgatcatgctcgcccctccaatgttaagaattatttattgaaatcatcccgttttatttacaataaaattatgcgatagctcgttgtttcggtacgaaattat