Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71F9B_286.b   

sjj_Y71F9B_286.b RNAi JA:Y71F9B_286.b
Simmer:Y71F9B_286.b:Screen_A
Simmer:Y71F9B_286.b:Screen_B
PCR_productsjj_Y71F9B_286.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71F9B.4 Source_evidenceePCR234WS150 Sequence/Annotation Release
Overlaps_Gene Y71F9B.4 Source_evidenceePCR481WS150 Sequence/Annotation Release
Chunk_score Abs_score439
Max_abs_score439Y71F9B.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI27268982728000
Overlaps_transcriptY71F9B.4 Source_evidenceePCR481WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71F9B_286.b1103ttcgataggtggaagttgaaaaatgagctttattttctattttaagtaaaatctgtttctttgatgatttttccattcttcattttcatttccccctgcaaattctcaatttttcagaaaaatgagtaagacacatccaccagagctcaaaaagtacatggacaaggagatggacttgaagctcaacggaaaccgtcgcgtctctggaatcctccgcggtttcgatccattcatgaacatggtcatcgacgtatgtttctttttccgtttttgtctaatttattctaaaatttaatattgcaggaagctgtcgagtaccaaaaggacggaggatccgtcaacctcggcatgactgtcattcgcggaaactccgtcgtcatcatggagcccaaggagagaatctcctagatttttcgatctccacaatttcctgtcactttctcaatgttttcattttcaaattttgatattaaatttttgaaccttttttttgataatttttgataactacgtggtcaaaacccacttctcatctctgattcacgtgaatttcgtatagataagaacttcgcaaatagaatcaattcacaaacaaatgtaccaaaagttatgttttattattgcaggcataaaaaaaatcaatcgtaaagctttttttcagcattttgtttttccacggctcaaattgaacgaaatagtgttcattttgaagagaggcacgaaacagagtaacaaaaacacggagagacttgtgtatccctcttctctttccactatgtgcggtcgacgacgctctccacatttttctctctttattcttctcgttactcttactcggcacaacagcagcaaaaaagaatactctttccccacttcttatctctttttctgccgacctattttcttctttcaaaacagaaaaatgttccacacacacgcctatcatcatccgaaagctgtacgagatgtgctttctcatctttccgtactcttgtggctgcagccgtcgaagagttgaaatatcaattttcaaaacgcggcagattctcagccggaattcagtgaattcgcttgatttctcgccaaaatatagaaatcagacg