Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71F9B_297.d   

sjj_Y71F9B_297.dRNAiJA:Y71F9B_297.d
PCR_productsjj_Y71F9B_297.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71F9B.2 Source_evidenceePCR177WS150 Sequence/Annotation Release
Overlaps_Gene Y71F9B.2 Source_evidenceePCR177WS150 Sequence/Annotation Release
Chunk_score Abs_score156
Max_abs_score156Y71F9B.2
Specificity_index0.675
Rel_score1
Map_statusBest_ePCRI27347662735441
Y71F9B.8 Source_evidenceePCR96WS150 Sequence/Annotation Release
Chunk_score Abs_score75
Specificity_index0.325
Rel_score0.481
Map_statusTop50_percentile_ePCRI27347662735441
Overlaps_transcript Y71F9B.8 Source_evidenceePCR96WS150 Sequence/Annotation Release
Y71F9B.2 Source_evidenceePCR177WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71F9B_297.d676aaatttcgcatctgggtaaaaatttttcaacaatctaaatatcgtaattttaaagtttcttaaaaatcggatttgcttcaaaaatacggtgcccggtctcgacacgacatgttttttgttagatgcgaaaaggagtgtgcctttaaagagtactgtaatttccagtttttgcggatttttcagtgatttttcatcgattttcaataagattgaaaaaatatttagaaaactataaaaattctgcaaaagtttgaaattacagtactctttaaaggcgcacaccgtttagcatcaaacaaaaattgtcgtgccgagatcaaagttacgcgtatgtgtaataagtcgcttcgagacccaatccgacttttgcaggtaatcttttcgcttgctcaccgacatgatgtggctgcgaccgttgaaaccgcaatcggcggaatcatccgaccagtctccctgtctcaaaccgcgaagaacgccttctcggccggagtcacccgttcaatcatctacagtatggcaaagatgagcaagttcttgaagagcaagtgatgataatttcgtgataacaagtttagaatggtttatagttaataaatttatttgatttaaagaaaaaaaagttattaaaaaagttaaaaaacaacctgatgaggggtgagagactcgtttgaacaat