Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71G12A_200.b   

sjj_Y71G12A_200.bRNAiJA:Y71G12A_200.b
PCR_productsjj_Y71G12A_200.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71G12B.31 Source_evidenceePCR323WS150 Sequence/Annotation Release
Overlaps_Gene Y71G12B.31 Source_evidenceePCR323WS150 Sequence/Annotation Release
Chunk_score Abs_score261
Max_abs_score261Y71G12B.31
Specificity_index0.789
Rel_score1
Map_statusUnique_ePCRI16870321688130
F36F12.4 Chunk_score Abs_score70
Specificity_index0.211
Rel_score0.268
Overlaps_transcriptY71G12B.31 Source_evidenceePCR323WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71G12A_200.b1099tgtcaaatatgttgcgaaatacgcattttcagaattttatgttaccgtaatatttcctgggggacaaatcaaaatttcagaatatcaatgttctgttttaaaaaattcaaatgttctatttttctatgtaaaatttcaatttttgcactaaaaaaacaaattttcgatcttcagtaaacaaaaaaaaattaaaatttaattgaaagtctaattttagaaatctaattttctcaaatttccgtgtatcttccaacaaaaaagtcacggggttctggccttcctcattgaatttttcgcgctccattgacaatcgcccaccggacaacgcgtgggaaagtcgtgtactccacacggacaaatacatttagttttacagctaaaatcgagccgcgacgcgacacgcaacgcgccgtaaatctaccccagatatggcctggcctagttcggcgaaaactcttccatttcaatttatgagggacgccagaaatctgtgaattataaattatttagaccactatttttaacaacaaaaaatctcagttctgtttatttttccgcgtctcaatattttggtaaacaacgcatgaaattatgaagctggcaaaactacagaaaaatgtttttaaaaacataaaaggtatagacgacccttacaaacaaaaaaacaaatttgtttgtctgtctatcacacactctctctcccagtcccagaccaaatacttgaacgcacccacctgcagtgcacaacaatcggtgacgtgtattgtcgtcctctaacctgcagcaagaactcgagaaagttggcaattcgcggcgcaccgccagtgtccttccactctttgtattgccattgtgacactttcatgtgactctgttgtctgctggctcggctttttcggctgcttttagtgctcgagctgtaggagcttgtcggcgagacgtcgaactcacggtgcacccaggttttttcctcgagttcgcacacgagcttcacatcgacttctccgtatcgttcggtttttcccattgcggaaggccagtattctccgcatttttgctggaattttttttaaagttttgggcattactgaaactttgt