Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71G12A_203.a   

sjj_Y71G12A_203.aRNAiJA:Y71G12A_203.a
PCR_productsjj_Y71G12A_203.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71G12B.27 Source_evidenceePCR357WS150 Sequence/Annotation Release
Overlaps_Gene Y71G12B.27 Source_evidenceePCR361WS150 Sequence/Annotation Release
Chunk_score Abs_score319
Max_abs_score319Y71G12B.27
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI17974151798727
Overlaps_transcriptY71G12B.27 Source_evidenceePCR361WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71G12A_203.a1313ggaagcccaaagtcttacaaaatatctacactgctttattcacaaattcatagaaaaccgcgttcaatttctcatcggttgctgtcgtttgctgttgcgctctattgaacacttccatatctctcaacaattccattttggcacgctcctcgtcggcttttgtgaaatggcgcttccgacggaacaagagaatgtgcttctccgggttatgaaccatgtagtgctcccatccaagtgactgaaaagtatgaaaaatcaataattcggccacattcagaaatttaatattgattttttttcgtcgattttatgactatcggttttcttgaaatatcgattctatcaacatattaatgtttatttaaaacaaattttcattaaaggcaaattgccggaattgaaaatttcgggcaaatcggtaagccggccaattgccggaattgaaaatttctggcaaatcggcaaaccgacacatagccggaattgaaaatttctggcaaatcaaaaaaccggcaaattgccgaagtttaaaatttctggaaatcggcaaatcggcaaactgccggaattgaaaatttctggcaaattgccggaattgaaaatttctggcaagtcggctaaccggcaaattgccggaattgaaagttcctggcaaatcggcaaatcggcacatagccggaattgaaaatgtctggcaaatcggcaaaccggcacatagccggaattgaaaatgtctggcaaatcggcaaaccggcacatagccggaattgaaaatgtctggcaaatcggcaaaccggcacatagccggaattgaaaatttctggaaaatcggcaaaccggcaatttgccgaacatgagaatttccggcaaatcagcaaaccggcaattaaattatcgggccggcgtaaggcccacatttcgcacctcactcggctgggagccttgcttaatttaataaaaaatattttaaaatattggctttttcaaaatatcaattttgtgaattatcgatttttggaaaaatctattttttttaattatcgatttttttcctaaaatcttaacatatcacttaattgaaaatatacctgttgaactccagcacgtctccattcagcctcactaagaagtcttccctttggcacttttctcgagacggcttgcggaagaatgacgtggcgatattcgtattcatcatcttcgtaacgtggcgaatagtagatatcttccatttttcaaaaactcttattcttcgatgttaattgtacgacaagtagggaatgaatgattgttgaggagttttggaaatgttg