Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71G12A_203.g   

sjj_Y71G12A_203.gRNAiJA:Y71G12A_203.g
PCR_productsjj_Y71G12A_203.g
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71G12B.4 Source_evidenceePCR367WS150 Sequence/Annotation Release
Overlaps_Gene Y71G12B.4 Source_evidenceePCR393WS150 Sequence/Annotation Release
Chunk_score Abs_score330
Max_abs_score330Y71G12B.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI18080321810059
Overlaps_transcriptY71G12B.4 Source_evidenceePCR393WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71G12A_203.g2028gtaggctagacgcagagaaacaggccggcggcggccaaatcgatgtgagagagccccgtttcagtctttttgtgaggctcggctccgaatgccgcgcttctacctcctctcgtcatgcgcacttttggcgtttgccacgtcattttgcaatgctgaaaagtcacagattcgaatgccaggagtcgttccagaggtaaggaaaatgtttcataatatttgtaggttaggaataggtcataggtaattgtaaatttttaaaatttcgcaaattatttatacgcaaaattaatagattccccaatttttaaaaattaatatctggcttcaaactaactttttaaaaaatccccgtagccatttagttgcaaattttgtgctctttcagaatttaaaaaccaaatttaaaacgctttcatatccgctgagttcaagcagaaaaagtgaattttcagtcagaccttttagagcacaagttgggattgaatggaacttttccaaaatagttatttactttttggtatttaaaaaaaacttaaaggacgattcgttcttcaagtcgcggatctgggagcctggtggtgatctcactgggctataacttaagcttaagccacgtcctagccgggtactgagacaggtgggtaatccagtcgtggattgctccatttcccaatagataaactgagagaacctagggggtgaacccggacttgaacccgtgatctccagattgctagcggccaccactaccgaccgagctatcccggccccctttttactttatgatctaccctataatagtattgcacccgactacttaactttgaaacgttatatctcggtttgttttatcgatatcgatatattatcaactacgaaattatagaaaaagaactaacaaatattttgttagttgacaatttttgaataaaacaaacgataactgagatataagctgtcaaagttgaaaattagagtgcaattttaatagacgaaatacggtacggttttagcattctagtatgaagttccggaatcaacatccctaaacccaaattctgtagtatagtagacatccaatggctttacagttaaaactaccaagaaaagttaagaagttctctgaattgtgtaaaaaatgggtcgcgaccaataaactttttatggaagtttttggaaatcagcaagtttttaaacgttttttaaatgttctttttcaaattgaaacccattttttgccattttttgagccataagagcacactcttttattcggtagaaatttcgtagaagcatttgtttttcatccaatcccaatatcccgaattacttctagactacaaatatgtcactaagcaacggaatgcataaaacatgtctatgtcacttatccacgtcattcctaacaaactccaattccaggccgactcctacctatgcacatcgttggagcttagcgaccaggagaactatttgaccggtttcaaggccttgacaaccaagggaaccgcccatcacattctccttttcggatgtgaagaaccaggaagtgatgagcttgtttgggattgtggagaaatgaataagccggatgatgagatgccacgtgcgccaacctgtggaagtaaaccagcaattttgtacgcctgggcgttggatgcaccaccacttgaattgccgcaaggtttgtggcctcccagctaagtgaggcgcgaaatgtagttgcttgaagcggccgacaccttcggggttccgcagcttggtgtgtgcgcaacgtagtgcgaaaaggtggttattttaaagcggccgacacgttcggaggtccgcgcctcactatacatgcggtgtgggtgacgcagtgatgccggcgcggcgaccgctggagccggcgcgggcgcagttgctgcgaccccaaggaagtcctatagagatgagctcgtgctaaaaccctattgaatagcttaatccttccggaaggaatgataatcccatcaatatcggattaactagccttcaatggaattgtga