Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71H10B.1   

sjj_Y71H10B.1 RNAi JA:Y71H10B.1
Simmer:Y71H10B.1
PCR_productsjj_Y71H10B.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y71H10B.1b Source_evidenceePCR804WS150 Sequence/Annotation Release
Y71H10B.1c Source_evidenceePCR804WS150 Sequence/Annotation Release
Overlaps_Gene Y71H10B.1 Source_evidenceePCR804WS150 Sequence/Annotation Release
Chunk_score Abs_score741
Max_abs_score741Y71H10B.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX28359732836964
Overlaps_transcript Y71H10B.1a.1 Source_evidenceePCR804WS150 Sequence/Annotation Release
Y71H10B.1b Source_evidenceePCR804WS150 Sequence/Annotation Release
Y71H10B.1a.2 Source_evidenceePCR804WS150 Sequence/Annotation Release
Y71H10B.1c Source_evidenceePCR804WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y71H10B.1992ttcttttgtatttttgccaaggaaacaccgttcccaaacctaattatcaagttatatacctttcgacttgagaggcaaagaaggtagttcggcctccggttctaaaaagacttcccaaacatccatactcctcgtccatttgattggtaagtttctggaagaaattgtgatttcacaaactttatccgtaaaataaatattgaacctactctaatcttatcaacgatgtccttgacgacaggcttatgacgagaagctccatccaaattcttatagatgtcagccaacgtgctctccatatgtcccatctcatcgaacaatggcttgctatcagtccacacagtcagctcgttaacaagctccggaacaactaggaaggtcctccatccgcgggatttcttcgagcgaagtacatctccgaaaatgtgatctccgacgtaaaggacctcctttccacggcatttcatcattttttggaaagcgtcacaggatcctccagaatagacgactccttctctgagcggtccagtatgaattccgagtttgtaggatccggtgtcagtgttgacttctctaaaaactgttccctctgcaaaccatctcggcttgcacgaatctacaactatgatgttgaagtaggtcttccagtcatctcccaaaataaacttcatcatcacattagtgtacgtccagtcgctgttggtgaggaggaatgttttcttgccgtgctctctgagctggctcaagaaacgtggtgcacgctcatcacgaatgacatacttctccggattttccattacttgctttttcatcgtgctctgaaaatctcatctatttagtttccggaaacaagacatttgagtctcacctccacatgaacccagtcaataactcgtctcaaatcttggaaaattgatttgtatgacatcatcacctcgccacctttcactcccgtcttatcagtgagcctggaatttattggaaaatgttgc