Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71H2_388.d   

sjj_Y71H2_388.d RNAi JA:Y71H2_388.d
Simmer:Y71H2_388.d
PCR_productsjj_Y71H2_388.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y71H2AM.4 Source_evidenceePCR575WS150 Sequence/Annotation Release
Chunk_score Abs_score533
Max_abs_score533Y71H2AM.4
Specificity_index1
Rel_score1
Map_statusBest_ePCRIII27867622788227
Y71H2AM.5 Source_evidenceePCR95WS150 Sequence/Annotation Release
Map_statusBottom50_percentile_ePCRIII27867622788227
Overlaps_transcript (5)
WB_DNA_textsjj_Y71H2_388.d1466atttcttatggcgttatgagacgcttgaaatatctcattttttttaaaaatcatatttcccccaaataaataattttctcagtggaaaccatggctgactcaactcgcgtcagcgagaaggaaatcgagcgccgcgagacctttattcgcgcaggacacagagctcgtcacctggccgatccattcacatggagctacccattgaagggtgccagtgcaatgctcggaatctcgctggcttcggtttatttgcaaaatcgatggaacaagaagccgtactactacgcaattgttccacggcttttgctcatcggagccgccaccgccgccggatacgctgccggagcacttcgagagagacactatcagacgagagacgcagtcatcgagcactacatgaagcttcatccagaggatttcgaccattttaatgatcgtgagttttggaatttgctgaaaaatcgattttcagattttactgcaatttcgaaaaaaaaacccggctgaattcgatcaaatttgaaagatttcggctttttccccccagagaataccgtatttttcgcgattttctgtgataaatgcagaaaatatatacattttccccgaaaaaaaaacgctgaaaaggagaagatttggctaaaatgctcgatttcggaccaatttttgcattcaaacacccaaatcaatgatttttatcttaaaaatagcaaaaattggcgtgaaaaaccgattttagcctaaaacaccatggaaaactacaaattatcggttttttcgtattttttaacagtaaattcgtcattgttcatgtaaaatactataaatcaccgatttttatgttaaattcagaaaaaaaatagtgaaaatggcgcatttcagcttaatcttctcctcgaggagtacacgagctgcgtaaatcgacacatcacagaaaacttgaattttggactagaattcagtttttttttcgcaattctaagtaattattttggaaattagtgcgaaaaaaagggaattctggctaaaaaattcaaaatttctgggaaaacggaagattttctagtgaaaaatgcaagaaaatcatcaaaaattcatggaatctatttatttttcaggcagtggacgttcattctctcaagttcttcttccatggtatccacgcagaacccagtacaccagatacgactgaacaattctctcgaagtctctttttagttcattattgtaaattaaatgaagaattattgatttttttcccggaaaattctcatttttttcatttttcagcatccatctggtcttttgagccgttttgaatataactaattaacccagaagcaattttggggcaaaaatactatactatatcctgggtctcgacgcgacaatttgtgttaaatgcgaagagggatgcgcctttaaaaagtactgtagttttaaacttttgttccggtggtttttat