Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y75B12B.4   

sjj_Y75B12B.4RNAiJA:Y75B12B.4
PCR_productsjj_Y75B12B.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY75B12B.4 Source_evidenceePCR963WS150 Sequence/Annotation Release
Overlaps_Gene Y75B12B.4 Source_evidenceePCR963WS150 Sequence/Annotation Release
Chunk_score Abs_score900
Max_abs_score900Y75B12B.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1519099115192150
Overlaps_transcriptY75B12B.4 Source_evidenceePCR963WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y75B12B.41160gcattgctcagcttaaattgtttgtttcaaattcttcttcattgttcaaattaaatttatcacaagataaaatgtctggaaaagacaataaaggatcaattcgttttgagattcaaaatttttctggcttggcgaaggcgacggagcacaaaccagtgcaaattggacacgtagaatggttagtgaattttaatgaaacaaaaaatgttctaaattatttaaaatattatcttttaaggattcttggagcattcacaagcacttccgacgctacgaacaatgctaaacatctcggaattcacctgaaatgcaacgaggaactgcgcagcaacttgtggtcctgcgatgcgtcaattcgtttttcacttctgagactcaattcaaacgaggatgatgacgcgttttcgatggagtttcagcaaaagttcgacgacttgaacaagattgtggtggtcaacaattttaaaaattgggaggaagccatctgctacgataatcgatttgtgctcgataagcatgccgttcttgaagtccaaattactgtcaacaagattgccggaattcatgagaggattatcgagactttcgatcaacccaaggaacatcttaccgatgttgtgctggtgcttgaaggaaaacatgtccatgttggcaagcaagtgctcgcaacgagctcgcaattcttccaaaaaatgttctattcgaatttcgccgaaaagacacaggctgagatcaaaatcgatgatgtgacccactctgagtttatcgatttgctcaatgtgatctaccccactcacatgctcattaatagtaagttcttttttttatttgaggcttggaattattaacggattttcaggttccaacgtgtctcacttgctcaagctgagcgatagattcgcggtgccaagagttctggaaaaggctgaaacgtttttgattttggaccaaaagacccacttgatcgacaagctgaagttcgccgaagtctacagactctcaaggcttcaaaatgcatgcctttcgcaattggagaccagcgaagatgttactgcgttgaagcatcacgaaaattataaatctctcgatcatataacctacaatgcgttgcttcagaagctcattgatcttttggaagattagctccaagctttgttgaa