Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y75B12B.9   

sjj_Y75B12B.9RNAiJA:Y75B12B.9
PCR_productsjj_Y75B12B.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC41G6.12 Source_evidenceePCR648WS150 Sequence/Annotation Release
Overlaps_Gene C41G6.12 Source_evidenceePCR648WS150 Sequence/Annotation Release
Chunk_score Abs_score627
Max_abs_score627C41G6.12
Specificity_index0.517
Rel_score1
Map_statusUnique_ePCRV1520848515210685
Y75B12B.9 Chunk_score Abs_score585
Specificity_index0.483
Rel_score0.933
Overlaps_transcriptC41G6.12 Source_evidenceePCR648WS150 Sequence/Annotation Release
WB_DNA_text sjj_Y75B12B.9_12201gtaggtggaaggcagaagtaggtagcctggtactctcgcagtacctcacaaatgcactctcccgactaggtcatatctacagtagttttatccgttcaactcaaacaaattttattattagcagatatagaattttcttttgaaggggtatcagaaccgcttttttgaaaaatatctataagatttttgagcagcaaacaatttttctggctggatatctaacttgtagaaaactagtgggtaagtagtcagacatttgaggacaaagagttttgagaatagtgctagattttcattttcagaacggaatcaaccaccagattgatcacattaatgtcagtgttctactttatgtcagaagttcctgtatttctggttggaatctatagaatattgagcgctgatgatgcgcgaaacacgtacgctccggggtttagttttatccttcaaattcagaatttcagaacaacggtagtacttcttcaagttccgctggttttcttcaccacagtcaactcaatatcccattttttcgtttgcctgttaatgtcgtctcaatataaagatacggtaaaaactgtacttggacttcagagagcacagactactgtatgaattttggaattggagaaaaagtggttaacgcttgaagtttcaggtatggtcagcggaggcagcgacaggcacaattccaaatagtctcacagcttgatattttgctttagcctctataatcaaaaggacagaaatacagacccaccgacaataaaccgtgaaacaacctttgtgacctttacgtggaaggtcatatcagataactatataagaaggagattgcggaagaaacatcagttctcaacagttttttttttcgtgctcgaccgtcttctcacttattgaactcattttgtgtggggatcttttggcgttcgccggaagatcccatttaataaacagtttattgttgcccgtgtattgcgttaaacaatatcagaaaattcactaagcttctatgcaaaaatgtcttgaaaaaagtttagattatttgaagattgcaaaatgagacaccactgccaaaattctacattgatggtccaactgacgatcctactttgtgtagataatctgggaattgtaaaagtttttctcagcttcctcgttttttattttactcattaaacaacttctttactattttacaataaccatgaaaacaatggtgtcgaacgaagaatagcttccaaaaatgcagaagatccatccagattgtacgtcgatattcaagtcaaacaacggtggcaataaaggactcatgagaaaagggacggctggaaaaaccagaaaaatagttggtccaatactctgtgcaaccaatgcacggagcaactgtttctggatattttgctgagccattgaaaatctggcaagcattttttgcatattgaagtgcattttgattccacaatacatgatgatagaataggcaatgacattgaagaaacatccaattgcaagtactacaaagttttcccactgtactgagccattgggataatatggtgtgatgttgaacttcgtgattttgtataccaccaaactataggtctcaaacattagatttctgaaatgtcttcttatttttaaaatcaagttcctgtgcctcataccgcatttcattatcaaatactgtttctcttgaaactattttaattgataaggcaaaagttggtcccggaattaatggaattgacattagacaatatccataaattccttcaagttttgcagcaaaatttgcattcaaaaggcataaatgtcggtttataaactgaatcgcaacgaagtataaaataagtgtgtgtaatccggcccaaatagccagcatccagcgaagaacttcttcagaatctatccaagtatttaaactaaagtagaacaacgtttgaccatgattatgtgcaaaaggctccaatgtcaaatcccatcccgagtaaacaatttaatgacaaagagaacaataatttgtaggtttcaatggaaacgggtacattttctaatctgtattctcattatcagtttttctaggtattcatgtgttttcaacagtattagttcttcttttctttaacctatatgcacatcctctgtgctctatttctgattatttttccatcaacgtcgttactgcatattcaatgcag
sjj_Y75B12B.9_22289ctgcattgaatatgcagtaacgacgttgatggaaaaataatcagaaatagagcacagaggatgtgcatataggttaaagaaaagaagaactaatactgttgaaaacacatgaatacctagaaaaactgataatgagaatacagattagaaaatgtacccgtttccattgaaacctacaaattattgttctctttgtcattaaattgtttactcgggatgggatttgacattggagccttttgcacataatcatggtcaaacgttgttctactttagtttaaatacttggatagattctgaagaagttcttcgctggatgctggctatttgggccggattacacacacttattttatacttcgttgcgattcagtttataaaccgacatttatgccttttgaatgcaaattttgctgcaaaacttgaaggaatttatggatattgtctaatgtcaattccattaattccgggaccaacttttgccttatcaattaaaatagtttcaagagaaacagtatttgataatgaaatgcggtatgaggcacaggaacttgattttaaaaataagaagacatttcagaaatctaatgtttgagacctatagtttggtggtatacaaaatcacgaagttcaacatcacaccatattatcccaatggctcagtacagtgggaaaactttgtagtacttgcaattggatgtttcttcaatgtcattgcctattctatcatcatgtattgtggaatcaaaatgcacttcaatatgcaaaaaatgcttgccagattttcaatggctcagcaaaatatccagaaacagttgctccgtgcattggttgcacagagtattggaccaactatttttctggtttttccagccgtcccttttctcatgagtcctttattgccaccgttgtttgacttgaatatcgacgtacaatctggatggatcttctgcatttttggaagctattcttcgttcgacaccattgttttcatggttattgtaaaatagtaaagaagttgtttaatgagtaaaataaaaaacgaggaagctgagaaaaacttttacaattcccagattatctacacaaagtaggatcgtcagttggaccatcaatgtagaattttggcagtggtgtctcattttgcaatcttcaaataatctaaacttttttcaagacatttttgcatagaagcttagtgaattttctgatattgtttaacgcaatacacgggcaacaataaactgtttattaaatgggatcttccggcgaacgccaaaagatccccacacaaaatgagttcaataagtgagaagacggtcgagcacgaaaaaaaaaactgttgagaactgatgtttcttccgcaatctccttcttatatagttatctgatatgaccttccacgtaaaggtcacaaaggttgtttcacggtttattgtcggtgggtctgtatttctgtccttttgattatagaggctaaagcaaaatatcaagctgtgagactatttggaattgtgcctgtcgctgcctccgctgaccatacctgaaacttcaagcgttaaccactttttctccaattccaaaattcatacagtagtctgtgctctctgaagtccaagtacagtttttaccgtatctttatattgagacgacattaacaggcaaacgaaaaaatgggatattgagttgactgtggtgaagaaaaccagcggaacttgaagaagtactaccgttgttctgaaattctgaatttgaaggataaaactaaaccccggagcgtacgtgtttcgcgcatcatcagcgctcaatattctatagattccaaccagaaatacaggaacttctgacataaagtagaacactgacattaatgtgatcaatctggtggttgattccgttctgaaaatgaaaatctagcactattctcaaaactctttgtcctcaaatgtctgactacttacccactagttttctacaagttagatatccagccagaaaaattgtttgctgctcaaaaatcttatagatatttttcaaaaaaaaaaaacttgaaaactctgaatgtttccaatacgcccatctactgaataatcccaaagtgacttgtgacgatgtgtctaaggctttatcagagactgataccccttcaaaagaaaattctatatctgctaataataaaatttgtttgagttgaacggataaaactactgtagatatgacctagtcgggagagtgcatttgtgaggtactgcgagagtaccaggctacctacttctgccttccacctac