Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y76G2B.a   

sjj_Y76G2B.a RNAi JA:Y76G2B.a
Simmer:Y76G2B.a:Repeat_b
Simmer:Y76G2B.a:Screen_A
Simmer:Y76G2B.a:Screen_B
PCR_productsjj_Y76G2B.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34G6.1 Source_evidenceePCR1485WS150 Sequence/Annotation Release
Overlaps_Gene C34G6.1 Source_evidenceePCR1485WS150 Sequence/Annotation Release
Chunk_score Abs_score1401
Max_abs_score1401C34G6.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI59085115910844
Overlaps_transcriptC34G6.1 Source_evidenceePCR1485WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y76G2B.a2334tcactcaaggaatttgtcgatttttagaagctgcatgtgtcgatgaaacatgcccattggaaccatatcttgaagatattcttaatgcacttttcccaaatgcttgtctcgatccagatgatactacagtaacccttagtactcaagcaatcaagaatcattccgaagcttttcgatgttttgatgttgctgctactagatttgctgatcgaattgtatactatcttctacataaaatgcaaaacgttgcggattctcaaaaacttggtgctataaacgttttgagacatcttctgaatgctactgggcagcatatggaagataagagatctctattgacaatgggattgaagaaacttcttgctgctgaaaacactactagtattcgagtaagtttttttaaaaataatttttgaatgaaaaaattagttttctgagataaccgacatttaatatatgccctaaacgacagaaaacaattagtatgccaaatataaatgagaaaaaattttaatgaatttttttttaatttttcaaagattgccgacaaatagattaactcaacccgttattcattttccagctacattgaaaaaagaaaccattaaaagtttttaaaaatctataattttttacagttatatttgaaatatttggagacaggttctctgtcatttaagacaaaaatcccacagacggttatatatcttaaaaagaaaaaaaaattctaagtgcatgttttaatcaccatcaagtcacaggtcaaacgagcaatagttcaactttgtgtcgctcttgctgatcattcatacgtggatgcagaaggtggagactatgtaattgcatttcttgtaagaaatcttgttggaccaactgaacaagaatccgcagccaagaaagttgaagttgatgttgctgggttaaatcaactacgaacacaatgtgcacaggctctctatacaattgcaaatacatgtgtttgtgcgacaaaacttttatggccatatctacttgaatttatatgctgtgaaaggtatacaccagttgttggagatttgtgcaagtgtttgagaacattagttagtcgagaagttgaagctggacgcaagatggactatgttacaggatttgataatcgtatgtttattttatattcttcatattctcaaaaatcaagaaaattgttaaaaaacctgtacggtacggtctcgacacgacaaatttctattgaatgcgataaagtacgcgcctttaaagagcactgtaattgaaaaatctcgtttcaatgattttttcatagttttttcacgatttgttaaaataatttttaatcgaaaactgaaatgtcaacgaaactttatgcggaaagtttgaagctacagtgcactttaaaggctcacacctttaaaatatgttcaataataagttgtcgtgtcaagaccagattccttgtttttggagaaaaatttcacaaaaaaaattcaatttaaaaaatcaaatttctcaacaaaaaactcgattttttcattaaaaaaaacgaagtctttgtaataacttaaccattttcagctaaagttgctggtcgtcatgcagtttttgcacgtcttttcacatctttttgcaatgctccattaaatgggctactcacaagacgagctagagaagctggtggtctcattcaggcagttgcaccatggttccacccttcgatggaaggaccagcagctagatggagtgaaaagttggaacctttgctggatggtaaggatctttaaatcatgtcatacatagttattctcaattcagaattatctacaactgtatcatccggtgattctgcacctgctgaacttcgtggtcgaaagattgccagatggcatgaagcatgtcttgattggctctcagcatgtgtggcagttgtcccagaaggagattggagacaagatttggctgctgcgatgggaaaacaattggatatgtacaaggaattgagcgatgaaaaatcatttttattaagatgtcttggagttacccttgcacggatcaccgcgaaacaatttgtaatagatcatatgatgctcatgttcaaatcagcatctcattccgtgttgactgaaagacaaggatgtgcacgtggagttggatctatagctacttcacacatggatttgattcttatcgagcttgaaaatgttagcaaatgggagcatgcaaggaaaagtagcggaatatttggtttcatcaaagacacaatgccaattcgacagtatccagatattgaaatgattcatcttcgagcaactctgatgctgtgttatggacatgttgtgatgg